Incidental Mutation 'R5710:Uaca'
ID452172
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Nameuveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms2700059D02Rik, nucling
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location60794542-60880370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60871811 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1158 (L1158Q)
Ref Sequence ENSEMBL: ENSMUSP00000151172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
Predicted Effect probably damaging
Transcript: ENSMUST00000050183
AA Change: L1160Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: L1160Q

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214354
AA Change: L1158Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216574
Predicted Effect possibly damaging
Transcript: ENSMUST00000217656
AA Change: L982Q

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Micall1 C A 15: 79,127,090 H553Q probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60872225 missense probably benign
IGL01751:Uaca APN 9 60869857 missense probably damaging 1.00
IGL02868:Uaca APN 9 60863637 missense probably damaging 1.00
IGL02977:Uaca APN 9 60866380 missense probably benign 0.00
IGL03037:Uaca APN 9 60840865 missense probably damaging 1.00
IGL03060:Uaca APN 9 60869866 missense probably damaging 1.00
IGL03083:Uaca APN 9 60863663 missense probably benign 0.28
IGL03266:Uaca APN 9 60863407 missense probably damaging 1.00
IGL03346:Uaca APN 9 60854318 missense probably damaging 1.00
R0408:Uaca UTSW 9 60871859 missense possibly damaging 0.71
R0567:Uaca UTSW 9 60871381 missense probably benign 0.01
R0598:Uaca UTSW 9 60870921 nonsense probably null
R0603:Uaca UTSW 9 60871097 missense possibly damaging 0.60
R0655:Uaca UTSW 9 60872029 missense probably benign 0.03
R0707:Uaca UTSW 9 60848618 splice site probably benign
R0791:Uaca UTSW 9 60872059 missense possibly damaging 0.50
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1520:Uaca UTSW 9 60871381 missense probably benign 0.30
R1673:Uaca UTSW 9 60872156 missense probably damaging 1.00
R1894:Uaca UTSW 9 60870436 missense possibly damaging 0.87
R1997:Uaca UTSW 9 60870341 missense probably damaging 1.00
R2042:Uaca UTSW 9 60869891 missense probably damaging 1.00
R2095:Uaca UTSW 9 60840843 missense probably benign 0.00
R2148:Uaca UTSW 9 60869679 missense probably damaging 1.00
R2384:Uaca UTSW 9 60869917 missense probably damaging 1.00
R3110:Uaca UTSW 9 60871499 missense probably damaging 1.00
R3112:Uaca UTSW 9 60871499 missense probably damaging 1.00
R4001:Uaca UTSW 9 60871084 missense probably benign 0.04
R4155:Uaca UTSW 9 60871753 missense probably benign 0.02
R4156:Uaca UTSW 9 60871753 missense probably benign 0.02
R4157:Uaca UTSW 9 60871753 missense probably benign 0.02
R4410:Uaca UTSW 9 60869891 missense probably damaging 1.00
R4674:Uaca UTSW 9 60854429 missense possibly damaging 0.94
R4871:Uaca UTSW 9 60846001 missense probably damaging 1.00
R5130:Uaca UTSW 9 60880228 missense probably damaging 0.96
R5328:Uaca UTSW 9 60870532 missense probably benign 0.44
R5358:Uaca UTSW 9 60871148 missense probably benign
R5415:Uaca UTSW 9 60870139 missense possibly damaging 0.65
R5437:Uaca UTSW 9 60871451 missense probably benign
R5647:Uaca UTSW 9 60872098 missense probably benign 0.28
R5920:Uaca UTSW 9 60869603 missense probably benign 0.19
R5931:Uaca UTSW 9 60872012 missense probably damaging 0.97
R5933:Uaca UTSW 9 60840956 missense probably damaging 1.00
R5959:Uaca UTSW 9 60870770 missense probably damaging 1.00
R6193:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6195:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6242:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6243:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6244:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6274:Uaca UTSW 9 60850291 splice site probably null
R6670:Uaca UTSW 9 60872024 missense probably benign 0.09
R6883:Uaca UTSW 9 60869891 missense probably damaging 1.00
R7011:Uaca UTSW 9 60870368 missense probably damaging 1.00
R7111:Uaca UTSW 9 60871838 missense probably benign 0.06
R7146:Uaca UTSW 9 60870413 missense probably damaging 0.99
X0067:Uaca UTSW 9 60859149 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GTCCCAAAAGTACAGCGACG -3'
(R):5'- TGCTTGGTGGTCTGAACCTC -3'

Sequencing Primer
(F):5'- AAGCAGGCCTCCGAGATC -3'
(R):5'- GTGGTCTGAACCTCCGTCTG -3'
Posted On2017-01-03