Incidental Mutation 'R5710:Micall1'
ID452188
Institutional Source Beutler Lab
Gene Symbol Micall1
Ensembl Gene ENSMUSG00000033039
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing -like 1
SynonymsD15N2e, Mus EST 820961, D15Mit260
MMRRC Submission 044396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5710 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79108898-79136900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79127090 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 553 (H553Q)
Ref Sequence ENSEMBL: ENSMUSP00000042053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040320] [ENSMUST00000229031]
Predicted Effect probably damaging
Transcript: ENSMUST00000040320
AA Change: H553Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042053
Gene: ENSMUSG00000033039
AA Change: H553Q

DomainStartEndE-ValueType
CH 4 103 5.64e-19 SMART
low complexity region 113 135 N/A INTRINSIC
LIM 164 219 1.15e-5 SMART
low complexity region 241 250 N/A INTRINSIC
low complexity region 375 394 N/A INTRINSIC
low complexity region 414 467 N/A INTRINSIC
low complexity region 477 497 N/A INTRINSIC
low complexity region 515 530 N/A INTRINSIC
low complexity region 571 586 N/A INTRINSIC
DUF3585 685 825 5.07e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185944
Predicted Effect probably benign
Transcript: ENSMUST00000229004
Predicted Effect probably benign
Transcript: ENSMUST00000229031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230779
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230050P20Rik G T 9: 20,872,896 R138L possibly damaging Het
Adam28 G A 14: 68,609,908 H713Y probably damaging Het
Adam39 A T 8: 40,824,647 Y25F probably benign Het
Ankfn1 T C 11: 89,503,925 N278S probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap18 G A 10: 26,860,733 probably null Het
Bcl2a1b A C 9: 89,199,679 Q107P probably benign Het
Btbd9 A G 17: 30,228,868 S525P probably benign Het
Cabin1 A G 10: 75,647,018 S2093P probably benign Het
Ccnd1 T C 7: 144,938,044 D86G possibly damaging Het
Chdh C A 14: 30,034,627 Q337K probably damaging Het
Cldn9 T C 17: 23,683,447 D68G probably damaging Het
Cpt1b T A 15: 89,425,206 K41N probably damaging Het
Dsg1c T C 18: 20,272,351 Y274H probably benign Het
Eif2ak3 T A 6: 70,883,733 I431N probably damaging Het
Erbb2 T A 11: 98,427,080 W416R probably damaging Het
Fgd3 T A 13: 49,296,729 I15F probably benign Het
Fkbp14 T A 6: 54,589,270 probably null Het
Havcr1 T C 11: 46,752,526 V91A probably damaging Het
Kmt2d T C 15: 98,854,106 probably benign Het
Lipc T A 9: 70,812,697 I343F probably benign Het
Madd T C 2: 91,154,476 T1331A probably damaging Het
Mcm5 A C 8: 75,120,910 D445A probably damaging Het
Mdga2 C A 12: 66,506,782 L98F probably damaging Het
Mxd4 A G 5: 34,187,327 probably null Het
Peg10 CC CCCCATCAGGC 6: 4,756,350 probably benign Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Prtg T A 9: 72,809,640 Y88N probably damaging Het
Saxo1 C T 4: 86,445,035 V404I possibly damaging Het
Sclt1 C A 3: 41,663,963 E14* probably null Het
Strn G A 17: 78,687,599 L162F probably damaging Het
T T C 17: 8,441,642 S221P probably benign Het
Tbl1xr1 A G 3: 22,210,414 D511G probably damaging Het
Ttc7 A C 17: 87,290,246 N82T probably damaging Het
Ttn C T 2: 76,917,442 R4421H possibly damaging Het
Uaca T A 9: 60,871,811 L1158Q probably damaging Het
Vdr T C 15: 97,859,127 Y288C probably damaging Het
Vdr A T 15: 97,867,208 S217T probably benign Het
Zhx2 T A 15: 57,821,470 Y78* probably null Het
Znhit1 C T 5: 136,982,602 C119Y probably damaging Het
Other mutations in Micall1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Micall1 APN 15 79115021 splice site probably benign
IGL00496:Micall1 APN 15 79115021 splice site probably benign
IGL00508:Micall1 APN 15 79130568 missense probably damaging 0.99
IGL01626:Micall1 APN 15 79130512 missense possibly damaging 0.46
IGL01868:Micall1 APN 15 79115060 missense probably benign 0.41
IGL03062:Micall1 APN 15 79114681 missense probably damaging 1.00
R0086:Micall1 UTSW 15 79125489 utr 3 prime probably benign
R0099:Micall1 UTSW 15 79131901 splice site probably benign
R0282:Micall1 UTSW 15 79131901 splice site probably benign
R0727:Micall1 UTSW 15 79120778 missense probably benign 0.00
R1859:Micall1 UTSW 15 79122945 intron probably benign
R2142:Micall1 UTSW 15 79130795 missense probably damaging 0.98
R2228:Micall1 UTSW 15 79129836 missense probably damaging 1.00
R3508:Micall1 UTSW 15 79122765 missense probably damaging 1.00
R4858:Micall1 UTSW 15 79122946 intron probably benign
R4888:Micall1 UTSW 15 79131848 nonsense probably null
R5059:Micall1 UTSW 15 79122834 intron probably benign
R5097:Micall1 UTSW 15 79129878 missense probably benign 0.17
R5451:Micall1 UTSW 15 79126904 intron probably null
R5727:Micall1 UTSW 15 79130478 missense possibly damaging 0.64
R7135:Micall1 UTSW 15 79109424 missense unknown
R7186:Micall1 UTSW 15 79125375 missense unknown
R7297:Micall1 UTSW 15 79120897 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGAACAGCTATCCACGCC -3'
(R):5'- CACCTTGATTTGCAGCTGTG -3'

Sequencing Primer
(F):5'- AGCTATCCACGCCTCCCG -3'
(R):5'- GGTCTCCAGCCAACAAGAAGG -3'
Posted On2017-01-03