Incidental Mutation 'R5711:Aqp7'
ID 452204
Institutional Source Beutler Lab
Gene Symbol Aqp7
Ensembl Gene ENSMUSG00000028427
Gene Name aquaporin 7
Synonyms AQP7L, AQPap
MMRRC Submission 043185-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5711 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 41033074-41048139 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 41035510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 115 (T115I)
Ref Sequence ENSEMBL: ENSMUSP00000093007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030136] [ENSMUST00000054945]
AlphaFold O54794
Predicted Effect probably benign
Transcript: ENSMUST00000030136
AA Change: T115I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030136
Gene: ENSMUSG00000028427
AA Change: T115I

DomainStartEndE-ValueType
Pfam:MIP 12 257 7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054945
AA Change: T115I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093007
Gene: ENSMUSG00000028427
AA Change: T115I

DomainStartEndE-ValueType
Pfam:MIP 12 257 1.6e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149517
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aquaporin family of water-selective membrane channels. The encoded protein localizes to the plasma membrane and allows movement of water, glycerol and urea across cell membranes. This gene is highly expressed in the adipose tissue where the encoded protein facilitates efflux of glycerol. In the proximal straight tubules of kidney, the encoded protein is localized to the apical membrane and prevents excretion of glycerol into urine. The encoded protein is present in spermatids, as well as in the testicular and epididymal spermatozoa suggesting an important role in late spermatogenesis. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related aquaporin gene on chromosome 9. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice for one allele show decreased circulating glycerol levels and fasting hypoglycemia. Other mutant alleles show increased gonadal fat pad mass and adipocyte hypertrophy or increased urine glucose and impaired water permeability in the kidney, but have normal serum glycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 A T 13: 100,790,722 (GRCm39) T18S probably damaging Het
Arhgap19 A G 19: 41,773,227 (GRCm39) V275A possibly damaging Het
Cebpz T A 17: 79,242,040 (GRCm39) Q538L probably damaging Het
Chgb A T 2: 132,634,618 (GRCm39) I187F probably benign Het
Cldn1 C A 16: 26,190,167 (GRCm39) L70F probably damaging Het
Crybg2 A T 4: 133,809,938 (GRCm39) D1230V probably damaging Het
Csmd1 C T 8: 16,003,703 (GRCm39) C2617Y probably damaging Het
D7Ertd443e T A 7: 133,951,110 (GRCm39) N188Y probably benign Het
Ddx51 A G 5: 110,802,790 (GRCm39) I214M probably benign Het
Dlg5 A G 14: 24,200,716 (GRCm39) V1328A probably damaging Het
Dnah2 C T 11: 69,326,216 (GRCm39) C3639Y probably damaging Het
Dync1i2 C T 2: 71,081,326 (GRCm39) T511I probably benign Het
Fam220a A T 5: 143,549,212 (GRCm39) E208V probably damaging Het
Gm4846 T C 1: 166,311,594 (GRCm39) S422G probably benign Het
Grin2c C T 11: 115,141,115 (GRCm39) R1001Q probably benign Het
H2-T3 T C 17: 36,498,301 (GRCm39) E248G probably damaging Het
Idi2 T C 13: 9,008,518 (GRCm39) V92A probably benign Het
Iqcd C T 5: 120,740,571 (GRCm39) Q301* probably null Het
Klhl26 T C 8: 70,904,974 (GRCm39) D278G probably damaging Het
Mok G T 12: 110,774,503 (GRCm39) T228K probably damaging Het
Or1e22 A G 11: 73,377,008 (GRCm39) I214T probably damaging Het
Otogl G A 10: 107,612,978 (GRCm39) silent Het
Pabpc1 T C 15: 36,606,074 (GRCm39) I101V probably benign Het
Ppargc1a G T 5: 51,631,562 (GRCm39) Q356K probably damaging Het
Ptprt T A 2: 161,652,524 (GRCm39) D608V probably damaging Het
Rxfp1 C T 3: 79,586,054 (GRCm39) C96Y probably damaging Het
Scn11a A C 9: 119,618,990 (GRCm39) V784G probably damaging Het
Septin4 T C 11: 87,458,723 (GRCm39) S366P probably benign Het
Slc12a8 A G 16: 33,410,679 (GRCm39) Y226C probably damaging Het
Slc25a33 A G 4: 149,846,914 (GRCm39) V49A possibly damaging Het
Slc25a45 T C 19: 5,934,451 (GRCm39) S140P probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Spty2d1 G T 7: 46,647,845 (GRCm39) N361K possibly damaging Het
Stk4 G A 2: 163,941,674 (GRCm39) A297T probably benign Het
Thsd7b T A 1: 129,688,139 (GRCm39) N683K probably damaging Het
Tln2 T C 9: 67,299,829 (GRCm39) E141G probably benign Het
Tmem125 A T 4: 118,399,216 (GRCm39) C72S probably damaging Het
Ttn G T 2: 76,572,437 (GRCm39) T26152K probably damaging Het
Uhrf1 G A 17: 56,627,259 (GRCm39) G643D possibly damaging Het
Vmn2r50 C T 7: 9,774,299 (GRCm39) M532I possibly damaging Het
Other mutations in Aqp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Aqp7 APN 4 41,045,321 (GRCm39) nonsense probably null
IGL01871:Aqp7 APN 4 41,045,321 (GRCm39) nonsense probably null
IGL02173:Aqp7 APN 4 41,034,379 (GRCm39) nonsense probably null
IGL03139:Aqp7 APN 4 41,045,326 (GRCm39) missense probably benign 0.00
IGL03237:Aqp7 APN 4 41,034,884 (GRCm39) missense possibly damaging 0.68
IGL03241:Aqp7 APN 4 41,045,270 (GRCm39) splice site probably benign
IGL03055:Aqp7 UTSW 4 41,045,326 (GRCm39) missense probably benign 0.00
R0884:Aqp7 UTSW 4 41,034,929 (GRCm39) missense possibly damaging 0.86
R1617:Aqp7 UTSW 4 41,036,109 (GRCm39) missense probably null 0.74
R3551:Aqp7 UTSW 4 41,045,329 (GRCm39) missense probably benign 0.04
R5340:Aqp7 UTSW 4 41,034,347 (GRCm39) missense probably benign
R5689:Aqp7 UTSW 4 41,035,510 (GRCm39) missense probably benign 0.00
R5690:Aqp7 UTSW 4 41,035,510 (GRCm39) missense probably benign 0.00
R5691:Aqp7 UTSW 4 41,035,510 (GRCm39) missense probably benign 0.00
R5692:Aqp7 UTSW 4 41,035,510 (GRCm39) missense probably benign 0.00
R5710:Aqp7 UTSW 4 41,035,510 (GRCm39) missense probably benign 0.00
R5713:Aqp7 UTSW 4 41,035,510 (GRCm39) missense probably benign 0.00
R5751:Aqp7 UTSW 4 41,035,510 (GRCm39) missense probably benign 0.00
R5817:Aqp7 UTSW 4 41,035,510 (GRCm39) missense probably benign 0.00
R5820:Aqp7 UTSW 4 41,035,510 (GRCm39) missense probably benign 0.00
R5921:Aqp7 UTSW 4 41,036,093 (GRCm39) missense probably benign
R8422:Aqp7 UTSW 4 41,035,622 (GRCm39) missense probably benign 0.02
R8697:Aqp7 UTSW 4 41,045,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCTTTACTCTACTAGGGTTG -3'
(R):5'- GTGCGGTCTTTTCACAGAGAAC -3'

Sequencing Primer
(F):5'- ACTCTACTAGGGTTGGGGATTTG -3'
(R):5'- GGTCTTTTCACAGAGAACATCCC -3'
Posted On 2017-01-03