Incidental Mutation 'R5711:Pabpc1'
ID452235
Institutional Source Beutler Lab
Gene Symbol Pabpc1
Ensembl Gene ENSMUSG00000022283
Gene Namepoly(A) binding protein, cytoplasmic 1
SynonymsPabp1, Pabpl1
MMRRC Submission 043185-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #R5711 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location36595661-36609668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36605830 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 101 (I101V)
Ref Sequence ENSEMBL: ENSMUSP00000001809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001809] [ENSMUST00000226496]
Predicted Effect probably benign
Transcript: ENSMUST00000001809
AA Change: I101V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000001809
Gene: ENSMUSG00000022283
AA Change: I101V

DomainStartEndE-ValueType
RRM 12 85 6.86e-22 SMART
RRM 100 171 2.72e-25 SMART
RRM 192 264 5.39e-29 SMART
RRM 295 366 5.83e-25 SMART
low complexity region 455 462 N/A INTRINSIC
low complexity region 492 509 N/A INTRINSIC
PolyA 554 617 6.9e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156793
Predicted Effect probably benign
Transcript: ENSMUST00000226496
AA Change: I101V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226867
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and binds to the 3' poly(A) tail of eukaryotic messenger RNAs via RNA-recognition motifs. The binding of this protein to poly(A) promotes ribosome recruitment and translation initiation; it is also required for poly(A) shortening which is the first step in mRNA decay. The gene is part of a small gene family including three protein-coding genes and several pseudogenes.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 A T 13: 100,654,214 T18S probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgap19 A G 19: 41,784,788 V275A possibly damaging Het
Cebpz T A 17: 78,934,611 Q538L probably damaging Het
Chgb A T 2: 132,792,698 I187F probably benign Het
Cldn1 C A 16: 26,371,417 L70F probably damaging Het
Crybg2 A T 4: 134,082,627 D1230V probably damaging Het
Csmd1 C T 8: 15,953,703 C2617Y probably damaging Het
D7Ertd443e T A 7: 134,349,381 N188Y probably benign Het
Ddx51 A G 5: 110,654,924 I214M probably benign Het
Dlg5 A G 14: 24,150,648 V1328A probably damaging Het
Dnah2 C T 11: 69,435,390 C3639Y probably damaging Het
Dync1i2 C T 2: 71,250,982 T511I probably benign Het
Fam220a A T 5: 143,563,457 E208V probably damaging Het
Gm11492 T C 11: 87,567,897 S366P probably benign Het
Gm4846 T C 1: 166,484,025 S422G probably benign Het
Grin2c C T 11: 115,250,289 R1001Q probably benign Het
H2-T3 T C 17: 36,187,409 E248G probably damaging Het
Idi2 T C 13: 8,958,482 V92A probably benign Het
Iqcd C T 5: 120,602,506 Q301* probably null Het
Klhl26 T C 8: 70,452,324 D278G probably damaging Het
Mok G T 12: 110,808,069 T228K probably damaging Het
Olfr381 A G 11: 73,486,182 I214T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppargc1a G T 5: 51,474,220 Q356K probably damaging Het
Ptprt T A 2: 161,810,604 D608V probably damaging Het
Rxfp1 C T 3: 79,678,747 C96Y probably damaging Het
Scn11a A C 9: 119,789,924 V784G probably damaging Het
Slc12a8 A G 16: 33,590,309 Y226C probably damaging Het
Slc25a33 A G 4: 149,762,457 V49A possibly damaging Het
Slc25a45 T C 19: 5,884,423 S140P probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Spty2d1 G T 7: 46,998,097 N361K possibly damaging Het
Stk4 G A 2: 164,099,754 A297T probably benign Het
Thsd7b T A 1: 129,760,402 N683K probably damaging Het
Tln2 T C 9: 67,392,547 E141G probably benign Het
Tmem125 A T 4: 118,542,019 C72S probably damaging Het
Ttn G T 2: 76,742,093 T26152K probably damaging Het
Uhrf1 G A 17: 56,320,259 G643D possibly damaging Het
Vmn2r50 C T 7: 10,040,372 M532I possibly damaging Het
Other mutations in Pabpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01602:Pabpc1 APN 15 36599306 missense probably benign 0.36
IGL01605:Pabpc1 APN 15 36599306 missense probably benign 0.36
IGL01973:Pabpc1 APN 15 36599275 missense probably benign 0.13
R0309:Pabpc1 UTSW 15 36597493 missense possibly damaging 0.93
R0667:Pabpc1 UTSW 15 36598031 missense probably benign
R0883:Pabpc1 UTSW 15 36599054 unclassified probably benign
R1682:Pabpc1 UTSW 15 36605541 missense possibly damaging 0.75
R1749:Pabpc1 UTSW 15 36608340 missense probably damaging 1.00
R4731:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4732:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4733:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4825:Pabpc1 UTSW 15 36597011 missense probably damaging 0.98
R5324:Pabpc1 UTSW 15 36600625 missense probably damaging 1.00
R5328:Pabpc1 UTSW 15 36602877 missense probably benign 0.03
R6073:Pabpc1 UTSW 15 36600651 missense probably damaging 0.97
R6751:Pabpc1 UTSW 15 36597534 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTAGAAATGTTAGCCACCCAATC -3'
(R):5'- AGTTGAGCTGAGGCCACATG -3'

Sequencing Primer
(F):5'- TGTTAGCCACCCAATCCCAGG -3'
(R):5'- ACTCCCTGTCACTGGTAATTTTATAC -3'
Posted On2017-01-03