Incidental Mutation 'R5722:Cntnap5c'
ID452295
Institutional Source Beutler Lab
Gene Symbol Cntnap5c
Ensembl Gene ENSMUSG00000038048
Gene Namecontactin associated protein-like 5C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5722 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57769570-58410355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58313857 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 977 (H977L)
Ref Sequence ENSEMBL: ENSMUSP00000075416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076038]
Predicted Effect probably benign
Transcript: ENSMUST00000076038
AA Change: H977L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048
AA Change: H977L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 29 174 1.26e-10 SMART
LamG 201 338 1.57e-29 SMART
LamG 387 521 3e-26 SMART
EGF 549 583 1.88e-1 SMART
Blast:FBG 586 769 8e-83 BLAST
LamG 811 938 4.37e-28 SMART
EGF 959 995 6.55e-1 SMART
LamG 1036 1172 2.08e-11 SMART
transmembrane domain 1240 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,204,123 T355S probably benign Het
4930432K21Rik A G 8: 84,171,844 E537G probably damaging Het
Actl6a G A 3: 32,718,045 R164H probably damaging Het
Afg3l2 A G 18: 67,440,199 Y178H probably benign Het
Agtr1a A G 13: 30,382,033 *360W probably null Het
Arfgef1 A G 1: 10,138,884 V1830A probably benign Het
Asic2 A T 11: 81,967,980 S69T probably benign Het
Axin1 A T 17: 26,182,557 N368Y probably damaging Het
Ces1d G A 8: 93,178,128 P328L probably benign Het
Cndp2 T A 18: 84,668,078 K461* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm7168 T C 17: 13,949,562 V397A probably benign Het
Hif1a T A 12: 73,941,759 D535E probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ice1 T C 13: 70,615,100 E173G possibly damaging Het
Ighmbp2 A G 19: 3,279,909 V115A probably damaging Het
Irf2 A T 8: 46,818,796 E101D possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kyat1 C T 2: 30,188,111 C127Y probably damaging Het
Mrgpra4 T C 7: 47,981,007 H282R probably benign Het
Npsr1 C A 9: 24,313,800 P368Q probably damaging Het
Nwd1 G A 8: 72,675,244 V839M probably damaging Het
Olfr430 G T 1: 174,069,870 D191Y probably damaging Het
Olfr644 T A 7: 104,068,723 M103L probably damaging Het
P4ha3 A G 7: 100,305,991 D351G probably benign Het
Pard3b T A 1: 62,440,001 probably null Het
Pik3c2b G T 1: 133,103,836 G1505W probably damaging Het
Plppr5 A T 3: 117,621,065 I112L probably benign Het
Ptprq A G 10: 107,686,365 I575T possibly damaging Het
Ranbp3l A G 15: 9,000,832 E46G probably damaging Het
Rbm46 A G 3: 82,865,333 V164A possibly damaging Het
Sap25 A G 5: 137,641,451 E13G probably benign Het
Setbp1 A T 18: 78,856,645 V1269E possibly damaging Het
Smgc T A 15: 91,841,906 S18R possibly damaging Het
Snrk T C 9: 122,164,006 I345T probably benign Het
Sp4 T A 12: 118,299,241 I357F possibly damaging Het
Sra1 A G 18: 36,674,978 L399P probably damaging Het
Stat6 A G 10: 127,658,373 T658A probably benign Het
Sv2a G A 3: 96,185,023 R13H probably benign Het
Thoc3 G T 13: 54,460,201 T310N probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tox3 A C 8: 90,347,861 probably null Het
Trpc6 A G 9: 8,680,549 E848G possibly damaging Het
Ttn T A 2: 76,708,246 T34703S possibly damaging Het
Ttn T C 2: 76,945,968 I1577V probably damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Ugt2b36 C T 5: 87,092,438 W29* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Zfp790 C A 7: 29,830,089 S733* probably null Het
Other mutations in Cntnap5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Cntnap5c APN 17 58162277 missense probably benign 0.00
IGL00543:Cntnap5c APN 17 58294350 missense probably benign
IGL00679:Cntnap5c APN 17 58055678 missense probably damaging 0.98
IGL00942:Cntnap5c APN 17 57769598 missense probably benign 0.03
IGL01352:Cntnap5c APN 17 58293901 missense probably benign 0.00
IGL01822:Cntnap5c APN 17 58055705 missense probably damaging 0.99
IGL01864:Cntnap5c APN 17 58410242 missense probably benign
IGL01922:Cntnap5c APN 17 58330119 missense possibly damaging 0.95
IGL02111:Cntnap5c APN 17 58102108 missense probably damaging 1.00
IGL02112:Cntnap5c APN 17 58313858 missense probably benign 0.00
IGL02259:Cntnap5c APN 17 58034862 missense probably damaging 0.98
IGL02270:Cntnap5c APN 17 58034853 missense probably benign 0.08
IGL02312:Cntnap5c APN 17 58138699 missense probably benign 0.09
IGL02456:Cntnap5c APN 17 58407744 splice site probably benign
IGL02755:Cntnap5c APN 17 58364194 missense probably benign 0.02
IGL02955:Cntnap5c APN 17 57892102 splice site probably benign
IGL03001:Cntnap5c APN 17 58055639 missense probably damaging 1.00
IGL03012:Cntnap5c APN 17 58359234 missense probably benign 0.01
IGL03243:Cntnap5c APN 17 58102176 missense probably benign 0.01
IGL03375:Cntnap5c APN 17 58162205 missense possibly damaging 0.94
IGL02802:Cntnap5c UTSW 17 58305684 missense probably benign 0.04
LCD18:Cntnap5c UTSW 17 58162160 intron probably benign
R0003:Cntnap5c UTSW 17 58199017 missense probably benign
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0179:Cntnap5c UTSW 17 57769625 missense probably benign 0.19
R0244:Cntnap5c UTSW 17 58102168 missense probably damaging 1.00
R0445:Cntnap5c UTSW 17 58104743 missense probably benign 0.01
R0626:Cntnap5c UTSW 17 58042427 missense probably benign 0.29
R0675:Cntnap5c UTSW 17 58034995 missense probably damaging 1.00
R0681:Cntnap5c UTSW 17 58305555 missense possibly damaging 0.91
R0699:Cntnap5c UTSW 17 58042498 missense probably damaging 1.00
R0927:Cntnap5c UTSW 17 58042558 missense possibly damaging 0.78
R1081:Cntnap5c UTSW 17 58305525 missense possibly damaging 0.90
R1132:Cntnap5c UTSW 17 58294356 missense probably damaging 1.00
R1175:Cntnap5c UTSW 17 58364246 missense possibly damaging 0.51
R1640:Cntnap5c UTSW 17 58395294 missense probably benign 0.01
R1664:Cntnap5c UTSW 17 58293990 missense probably benign 0.00
R1758:Cntnap5c UTSW 17 58042550 missense probably damaging 1.00
R1785:Cntnap5c UTSW 17 58162291 missense probably benign 0.00
R1789:Cntnap5c UTSW 17 58013921 missense probably damaging 1.00
R1968:Cntnap5c UTSW 17 58359296 missense probably damaging 1.00
R2041:Cntnap5c UTSW 17 58104770 critical splice donor site probably null
R2041:Cntnap5c UTSW 17 58198989 missense probably benign 0.02
R2073:Cntnap5c UTSW 17 58305552 missense possibly damaging 0.58
R2093:Cntnap5c UTSW 17 58199000 missense probably benign 0.00
R2134:Cntnap5c UTSW 17 58407722 missense probably damaging 1.00
R2153:Cntnap5c UTSW 17 58055671 missense possibly damaging 0.90
R2176:Cntnap5c UTSW 17 58013946 missense probably benign 0.04
R2256:Cntnap5c UTSW 17 58330315 missense probably benign 0.00
R2847:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2848:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2850:Cntnap5c UTSW 17 58410348 utr 3 prime probably benign
R3008:Cntnap5c UTSW 17 58359209 missense probably damaging 1.00
R3714:Cntnap5c UTSW 17 57892067 nonsense probably null
R3720:Cntnap5c UTSW 17 58330202 missense probably benign
R3755:Cntnap5c UTSW 17 58104599 missense possibly damaging 0.82
R4001:Cntnap5c UTSW 17 58407740 critical splice donor site probably null
R4619:Cntnap5c UTSW 17 58410268 missense probably benign
R5146:Cntnap5c UTSW 17 58013847 missense probably damaging 0.96
R5309:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5312:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5974:Cntnap5c UTSW 17 57876485 missense probably benign 0.00
R6017:Cntnap5c UTSW 17 58104698 missense probably benign 0.41
R6059:Cntnap5c UTSW 17 58313712 missense probably damaging 0.99
R6152:Cntnap5c UTSW 17 58286886 missense possibly damaging 0.65
R6182:Cntnap5c UTSW 17 57876395 missense probably benign 0.00
R6298:Cntnap5c UTSW 17 58104752 missense probably damaging 1.00
R6301:Cntnap5c UTSW 17 57892037 missense probably benign 0.01
R6514:Cntnap5c UTSW 17 58330170 missense probably damaging 0.96
R6583:Cntnap5c UTSW 17 58330277 missense probably damaging 1.00
R6688:Cntnap5c UTSW 17 58293904 missense possibly damaging 0.71
R6781:Cntnap5c UTSW 17 58138653 nonsense probably null
R6866:Cntnap5c UTSW 17 58092294 missense probably benign
R6906:Cntnap5c UTSW 17 58395307 missense probably benign 0.18
R6911:Cntnap5c UTSW 17 57892014 missense probably damaging 1.00
R6919:Cntnap5c UTSW 17 58293953 missense probably benign 0.02
R6923:Cntnap5c UTSW 17 58092350 missense possibly damaging 0.96
R6925:Cntnap5c UTSW 17 58395266 missense probably benign 0.39
R6982:Cntnap5c UTSW 17 58092252 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCCTGATTTCTGGGAAAGGG -3'
(R):5'- CAGGCTAAAACATGGCTTATGAGTAG -3'

Sequencing Primer
(F):5'- GGGGATAGTTAGAGATTCTGTAACC -3'
(R):5'- TGGCTTATGAGTAGTATACCATTACC -3'
Posted On2017-01-03