Incidental Mutation 'R5723:Actl7a'
ID452311
Institutional Source Beutler Lab
Gene Symbol Actl7a
Ensembl Gene ENSMUSG00000070979
Gene Nameactin-like 7a
SynonymsTact2, t-actin 2
MMRRC Submission 043341-MU
Accession Numbers

Ncbi RefSeq: NM_009611.3; MGI:1343051

Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R5723 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56743413-56744925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56744310 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 279 (D279G)
Ref Sequence ENSEMBL: ENSMUSP00000092692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095079] [ENSMUST00000095080] [ENSMUST00000181745]
Predicted Effect probably damaging
Transcript: ENSMUST00000095079
AA Change: D279G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092692
Gene: ENSMUSG00000070979
AA Change: D279G

DomainStartEndE-ValueType
Pfam:ACTL7A_N 6 70 1.3e-39 PFAM
ACTIN 74 440 4.63e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095080
SMART Domains Protein: ENSMUSP00000092693
Gene: ENSMUSG00000070980

DomainStartEndE-ValueType
ACTIN 51 418 1.6e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181745
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7A), and related gene, ACTL7B, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7A gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. The ACTL7A gene is expressed in a wide variety of adult tissues, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,953,619 D862G possibly damaging Het
Abcg2 C T 6: 58,678,351 Q109* probably null Het
Acbd7 A G 2: 3,340,418 Y33C probably damaging Het
Akr1c18 A T 13: 4,144,329 Y110* probably null Het
Akt1 T C 12: 112,657,270 K276E probably damaging Het
Bcas2 A G 3: 103,177,292 probably benign Het
C9 T A 15: 6,486,816 Y367N probably damaging Het
Cd163 A G 6: 124,319,063 T789A probably benign Het
Cers6 T A 2: 69,108,445 S344T probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Crisp3 A C 17: 40,235,913 V38G probably damaging Het
Cyp2b23 A G 7: 26,681,396 F135L probably benign Het
Ddr2 A T 1: 169,988,520 C539* probably null Het
Efna5 T A 17: 62,607,463 D189V probably damaging Het
Endov G T 11: 119,499,849 V70F probably damaging Het
Fam49b A T 15: 63,956,598 probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem3 A T 8: 80,613,397 H773L probably benign Het
Gm43302 T A 5: 105,217,486 Q552L possibly damaging Het
Gramd1a A T 7: 31,134,483 W506R probably damaging Het
Hmcn1 C T 1: 150,694,849 V2188I possibly damaging Het
Ifit1bl2 A G 19: 34,620,058 F53L probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Krt16 A G 11: 100,248,446 Y149H probably damaging Het
Krtap5-2 A T 7: 142,175,005 C313S unknown Het
Mreg A G 1: 72,162,368 I155T probably damaging Het
Nans T C 4: 46,499,083 F130S probably benign Het
Nox4 T C 7: 87,304,973 probably benign Het
Olfr178 A T 16: 58,889,613 Y202* probably null Het
Olfr411 C A 11: 74,347,128 W32L possibly damaging Het
Olfr600 A T 7: 103,346,619 M103K possibly damaging Het
Olfr679 C A 7: 105,091,102 C179F probably damaging Het
Pkd1 A G 17: 24,565,523 T348A probably benign Het
Poteg T C 8: 27,449,992 probably null Het
Prom1 T G 5: 44,014,894 N585T probably benign Het
Rfc1 T C 5: 65,277,426 S666G probably null Het
Rilp A G 11: 75,512,861 probably benign Het
Serpina3i A G 12: 104,265,500 E132G probably benign Het
Serpina3m T C 12: 104,393,911 V414A probably damaging Het
Sfrp4 T C 13: 19,623,698 F89S probably damaging Het
Stat5a A G 11: 100,882,074 H692R probably benign Het
Tex29 A T 8: 11,854,279 probably benign Het
Tmc5 T A 7: 118,672,193 F910I probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tusc3 G A 8: 39,071,497 G230D possibly damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Upb1 A T 10: 75,428,271 I184F probably damaging Het
Vamp4 T C 1: 162,574,363 F5L possibly damaging Het
Zfp583 C A 7: 6,323,675 Q68H probably damaging Het
Zfp831 A C 2: 174,645,407 H625P probably benign Het
Zfp941 G A 7: 140,812,850 probably benign Het
Other mutations in Actl7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Actl7a APN 4 56743944 missense possibly damaging 0.86
IGL01767:Actl7a APN 4 56743980 missense probably damaging 1.00
IGL02626:Actl7a APN 4 56744353 missense possibly damaging 0.89
R0046:Actl7a UTSW 4 56743877 nonsense probably null
R0046:Actl7a UTSW 4 56743877 nonsense probably null
R1741:Actl7a UTSW 4 56744252 missense probably benign 0.03
R1920:Actl7a UTSW 4 56744135 missense probably damaging 1.00
R2984:Actl7a UTSW 4 56744531 missense probably benign 0.00
R3716:Actl7a UTSW 4 56744295 missense possibly damaging 0.67
R4779:Actl7a UTSW 4 56743632 missense probably benign 0.07
R5391:Actl7a UTSW 4 56743661 missense probably benign
R5540:Actl7a UTSW 4 56744388 missense probably benign 0.00
R5902:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R5903:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R5922:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R6010:Actl7a UTSW 4 56743870 missense possibly damaging 0.50
R6786:Actl7a UTSW 4 56744116 nonsense probably null
R7168:Actl7a UTSW 4 56743769 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAATGCACATCGCCTAC -3'
(R):5'- GCATGGACTTGATTAGAGATGGC -3'

Sequencing Primer
(F):5'- GTCCATGTACTCCTACGGACG -3'
(R):5'- TGGCTTGAAGAACATCTCCG -3'
Posted On2017-01-03