Incidental Mutation 'R5723:Rfc1'
ID452313
Institutional Source Beutler Lab
Gene Symbol Rfc1
Ensembl Gene ENSMUSG00000029191
Gene Namereplication factor C (activator 1) 1
Synonyms140kDa, Recc1, Alp145, RFC140
MMRRC Submission 043341-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5723 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65261850-65335670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65277426 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 666 (S666G)
Ref Sequence ENSEMBL: ENSMUSP00000144980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172732] [ENSMUST00000203471] [ENSMUST00000203581] [ENSMUST00000204965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031092
AA Change: S666G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031092
Gene: ENSMUSG00000029191
AA Change: S666G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 5.2e-62 PFAM
low complexity region 1104 1131 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172660
AA Change: S665G

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133457
Gene: ENSMUSG00000029191
AA Change: S665G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 626 761 9.65e-10 SMART
Pfam:RFC1 898 1051 5.2e-62 PFAM
low complexity region 1103 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172732
AA Change: S665G

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134444
Gene: ENSMUSG00000029191
AA Change: S665G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 5.2e-62 PFAM
low complexity region 1104 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172780
AA Change: S679G

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133738
Gene: ENSMUSG00000029191
AA Change: S679G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 322 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
BRCT 415 493 7.39e-17 SMART
low complexity region 498 516 N/A INTRINSIC
AAA 640 775 9.65e-10 SMART
Pfam:RFC1 912 1065 2.6e-61 PFAM
low complexity region 1117 1145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203471
AA Change: S666G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144954
Gene: ENSMUSG00000029191
AA Change: S666G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 2.5e-61 PFAM
low complexity region 1104 1132 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203581
AA Change: S679G

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145385
Gene: ENSMUSG00000029191
AA Change: S679G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 322 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
BRCT 415 493 7.39e-17 SMART
low complexity region 498 516 N/A INTRINSIC
AAA 640 775 9.65e-10 SMART
Pfam:RFC1 912 1065 2.6e-61 PFAM
low complexity region 1117 1145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204965
AA Change: S666G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144980
Gene: ENSMUSG00000029191
AA Change: S666G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
BRCT 401 479 7.39e-17 SMART
low complexity region 484 502 N/A INTRINSIC
AAA 627 762 9.65e-10 SMART
Pfam:RFC1 899 1052 2.5e-61 PFAM
low complexity region 1104 1131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205063
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of replication factor C, a five subunit DNA polymerase accessory protein, which is a DNA-dependent ATPase required for eukaryotic DNA replication and repair. The large subunit acts as an activator of DNA polymerases, binds to the 3' end of primers, and promotes coordinated synthesis of both strands. It may also have a role in telomere stability. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,953,619 D862G possibly damaging Het
Abcg2 C T 6: 58,678,351 Q109* probably null Het
Acbd7 A G 2: 3,340,418 Y33C probably damaging Het
Actl7a A G 4: 56,744,310 D279G probably damaging Het
Akr1c18 A T 13: 4,144,329 Y110* probably null Het
Akt1 T C 12: 112,657,270 K276E probably damaging Het
Bcas2 A G 3: 103,177,292 probably benign Het
C9 T A 15: 6,486,816 Y367N probably damaging Het
Cd163 A G 6: 124,319,063 T789A probably benign Het
Cers6 T A 2: 69,108,445 S344T probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Crisp3 A C 17: 40,235,913 V38G probably damaging Het
Cyp2b23 A G 7: 26,681,396 F135L probably benign Het
Ddr2 A T 1: 169,988,520 C539* probably null Het
Efna5 T A 17: 62,607,463 D189V probably damaging Het
Endov G T 11: 119,499,849 V70F probably damaging Het
Fam49b A T 15: 63,956,598 probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem3 A T 8: 80,613,397 H773L probably benign Het
Gm43302 T A 5: 105,217,486 Q552L possibly damaging Het
Gramd1a A T 7: 31,134,483 W506R probably damaging Het
Hmcn1 C T 1: 150,694,849 V2188I possibly damaging Het
Ifit1bl2 A G 19: 34,620,058 F53L probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Krt16 A G 11: 100,248,446 Y149H probably damaging Het
Krtap5-2 A T 7: 142,175,005 C313S unknown Het
Mreg A G 1: 72,162,368 I155T probably damaging Het
Nans T C 4: 46,499,083 F130S probably benign Het
Nox4 T C 7: 87,304,973 probably benign Het
Olfr178 A T 16: 58,889,613 Y202* probably null Het
Olfr411 C A 11: 74,347,128 W32L possibly damaging Het
Olfr600 A T 7: 103,346,619 M103K possibly damaging Het
Olfr679 C A 7: 105,091,102 C179F probably damaging Het
Pkd1 A G 17: 24,565,523 T348A probably benign Het
Poteg T C 8: 27,449,992 probably null Het
Prom1 T G 5: 44,014,894 N585T probably benign Het
Rilp A G 11: 75,512,861 probably benign Het
Serpina3i A G 12: 104,265,500 E132G probably benign Het
Serpina3m T C 12: 104,393,911 V414A probably damaging Het
Sfrp4 T C 13: 19,623,698 F89S probably damaging Het
Stat5a A G 11: 100,882,074 H692R probably benign Het
Tex29 A T 8: 11,854,279 probably benign Het
Tmc5 T A 7: 118,672,193 F910I probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tusc3 G A 8: 39,071,497 G230D possibly damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Upb1 A T 10: 75,428,271 I184F probably damaging Het
Vamp4 T C 1: 162,574,363 F5L possibly damaging Het
Zfp583 C A 7: 6,323,675 Q68H probably damaging Het
Zfp831 A C 2: 174,645,407 H625P probably benign Het
Zfp941 G A 7: 140,812,850 probably benign Het
Other mutations in Rfc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Rfc1 APN 5 65296009 missense probably benign 0.00
IGL00909:Rfc1 APN 5 65279699 missense probably benign 0.00
IGL01791:Rfc1 APN 5 65263145 missense probably benign 0.00
IGL01884:Rfc1 APN 5 65274460 missense possibly damaging 0.94
IGL02737:Rfc1 APN 5 65311163 missense possibly damaging 0.82
Disturbing UTSW 5 65266162 missense probably damaging 1.00
P0038:Rfc1 UTSW 5 65287961 missense probably damaging 1.00
R0317:Rfc1 UTSW 5 65296052 splice site probably null
R0452:Rfc1 UTSW 5 65264297 missense probably benign 0.01
R0699:Rfc1 UTSW 5 65319399 splice site probably null
R0945:Rfc1 UTSW 5 65278709 critical splice donor site probably null
R1192:Rfc1 UTSW 5 65293911 missense probably benign 0.03
R1341:Rfc1 UTSW 5 65291194 missense probably damaging 1.00
R1425:Rfc1 UTSW 5 65319518 missense probably damaging 1.00
R1551:Rfc1 UTSW 5 65277363 missense probably damaging 0.99
R1800:Rfc1 UTSW 5 65264379 missense probably damaging 1.00
R1969:Rfc1 UTSW 5 65319524 missense probably damaging 1.00
R2006:Rfc1 UTSW 5 65311054 nonsense probably null
R2026:Rfc1 UTSW 5 65288029 missense probably damaging 1.00
R2073:Rfc1 UTSW 5 65301939 missense probably damaging 0.98
R2137:Rfc1 UTSW 5 65311039 critical splice donor site probably null
R2330:Rfc1 UTSW 5 65312969 missense possibly damaging 0.94
R3774:Rfc1 UTSW 5 65264406 missense probably damaging 1.00
R3787:Rfc1 UTSW 5 65296014 missense probably benign 0.00
R4920:Rfc1 UTSW 5 65287928 missense probably damaging 1.00
R5055:Rfc1 UTSW 5 65266162 missense probably damaging 1.00
R5308:Rfc1 UTSW 5 65279461 missense probably damaging 0.99
R5729:Rfc1 UTSW 5 65277452 missense probably damaging 1.00
R5844:Rfc1 UTSW 5 65293787 missense probably benign 0.19
R6045:Rfc1 UTSW 5 65279549 missense probably damaging 1.00
R6484:Rfc1 UTSW 5 65293677 missense probably benign 0.01
R6495:Rfc1 UTSW 5 65273815 intron probably null
R6531:Rfc1 UTSW 5 65312979 missense possibly damaging 0.92
R6717:Rfc1 UTSW 5 65302004 nonsense probably null
R6717:Rfc1 UTSW 5 65312961 missense probably damaging 0.97
R6845:Rfc1 UTSW 5 65311116 missense possibly damaging 0.53
R6880:Rfc1 UTSW 5 65277386 missense probably benign 0.14
R7329:Rfc1 UTSW 5 65263135 missense unknown
R7331:Rfc1 UTSW 5 65311044 missense probably damaging 1.00
R7466:Rfc1 UTSW 5 65275426 missense probably damaging 1.00
R7497:Rfc1 UTSW 5 65279498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCCAGAAGAGTTATGCC -3'
(R):5'- ATCTCTAATGCTGTGGGGAATTAG -3'

Sequencing Primer
(F):5'- GCCAAAGGCCTTTCCTATCTTGATG -3'
(R):5'- AGATTTGTGGCCTTTTGGTATCATAC -3'
Posted On2017-01-03