Incidental Mutation 'R5723:Olfr600'
ID452323
Institutional Source Beutler Lab
Gene Symbol Olfr600
Ensembl Gene ENSMUSG00000045540
Gene Nameolfactory receptor 600
SynonymsGA_x6K02T2PBJ9-6056235-6055291, MOR39-1
MMRRC Submission 043341-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5723 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103343482-103349669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103346619 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 103 (M103K)
Ref Sequence ENSEMBL: ENSMUSP00000148967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056222] [ENSMUST00000215042]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056222
AA Change: M103K

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053887
Gene: ENSMUSG00000045540
AA Change: M103K

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.1e-97 PFAM
Pfam:7TM_GPCR_Srsx 37 226 1.2e-12 PFAM
Pfam:7tm_1 43 305 7.2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215042
AA Change: M103K

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,953,619 D862G possibly damaging Het
Abcg2 C T 6: 58,678,351 Q109* probably null Het
Acbd7 A G 2: 3,340,418 Y33C probably damaging Het
Actl7a A G 4: 56,744,310 D279G probably damaging Het
Akr1c18 A T 13: 4,144,329 Y110* probably null Het
Akt1 T C 12: 112,657,270 K276E probably damaging Het
Bcas2 A G 3: 103,177,292 probably benign Het
C9 T A 15: 6,486,816 Y367N probably damaging Het
Cd163 A G 6: 124,319,063 T789A probably benign Het
Cers6 T A 2: 69,108,445 S344T probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Crisp3 A C 17: 40,235,913 V38G probably damaging Het
Cyp2b23 A G 7: 26,681,396 F135L probably benign Het
Ddr2 A T 1: 169,988,520 C539* probably null Het
Efna5 T A 17: 62,607,463 D189V probably damaging Het
Endov G T 11: 119,499,849 V70F probably damaging Het
Fam49b A T 15: 63,956,598 probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem3 A T 8: 80,613,397 H773L probably benign Het
Gm43302 T A 5: 105,217,486 Q552L possibly damaging Het
Gramd1a A T 7: 31,134,483 W506R probably damaging Het
Hmcn1 C T 1: 150,694,849 V2188I possibly damaging Het
Ifit1bl2 A G 19: 34,620,058 F53L probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Krt16 A G 11: 100,248,446 Y149H probably damaging Het
Krtap5-2 A T 7: 142,175,005 C313S unknown Het
Mreg A G 1: 72,162,368 I155T probably damaging Het
Nans T C 4: 46,499,083 F130S probably benign Het
Nox4 T C 7: 87,304,973 probably benign Het
Olfr178 A T 16: 58,889,613 Y202* probably null Het
Olfr411 C A 11: 74,347,128 W32L possibly damaging Het
Olfr679 C A 7: 105,091,102 C179F probably damaging Het
Pkd1 A G 17: 24,565,523 T348A probably benign Het
Poteg T C 8: 27,449,992 probably null Het
Prom1 T G 5: 44,014,894 N585T probably benign Het
Rfc1 T C 5: 65,277,426 S666G probably null Het
Rilp A G 11: 75,512,861 probably benign Het
Serpina3i A G 12: 104,265,500 E132G probably benign Het
Serpina3m T C 12: 104,393,911 V414A probably damaging Het
Sfrp4 T C 13: 19,623,698 F89S probably damaging Het
Stat5a A G 11: 100,882,074 H692R probably benign Het
Tex29 A T 8: 11,854,279 probably benign Het
Tmc5 T A 7: 118,672,193 F910I probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tusc3 G A 8: 39,071,497 G230D possibly damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Upb1 A T 10: 75,428,271 I184F probably damaging Het
Vamp4 T C 1: 162,574,363 F5L possibly damaging Het
Zfp583 C A 7: 6,323,675 Q68H probably damaging Het
Zfp831 A C 2: 174,645,407 H625P probably benign Het
Zfp941 G A 7: 140,812,850 probably benign Het
Other mutations in Olfr600
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Olfr600 APN 7 103346179 missense probably benign 0.15
IGL02239:Olfr600 APN 7 103346598 missense probably damaging 1.00
IGL02285:Olfr600 APN 7 103346038 nonsense probably null
IGL02547:Olfr600 APN 7 103346244 missense probably damaging 1.00
IGL03149:Olfr600 APN 7 103346849 missense probably benign 0.00
R0193:Olfr600 UTSW 7 103346204 missense possibly damaging 0.74
R0304:Olfr600 UTSW 7 103346711 missense probably damaging 1.00
R0454:Olfr600 UTSW 7 103346878 missense probably benign 0.02
R0622:Olfr600 UTSW 7 103346857 missense probably damaging 0.97
R1988:Olfr600 UTSW 7 103346109 missense possibly damaging 0.88
R1989:Olfr600 UTSW 7 103346109 missense possibly damaging 0.88
R2937:Olfr600 UTSW 7 103346065 missense probably benign 0.18
R4426:Olfr600 UTSW 7 103346083 missense probably damaging 1.00
R5362:Olfr600 UTSW 7 103346247 missense probably damaging 1.00
R6793:Olfr600 UTSW 7 103346266 missense probably benign 0.00
R6863:Olfr600 UTSW 7 103346916 missense possibly damaging 0.86
R6935:Olfr600 UTSW 7 103346795 missense probably damaging 1.00
R6983:Olfr600 UTSW 7 103346815 missense probably benign 0.00
R7262:Olfr600 UTSW 7 103346557 missense probably damaging 1.00
R7313:Olfr600 UTSW 7 103346331 missense probably benign 0.06
X0018:Olfr600 UTSW 7 103346899 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGCCATGTACGCACAGTAG -3'
(R):5'- AATCCTCCCATGGATGGTTCTC -3'

Sequencing Primer
(F):5'- ACTAATGACCTGGGTTTGGAATC -3'
(R):5'- TAGTAACCATCATAGGAAATGTCACC -3'
Posted On2017-01-03