Incidental Mutation 'R5723:Tmc5'
ID452326
Institutional Source Beutler Lab
Gene Symbol Tmc5
Ensembl Gene ENSMUSG00000030650
Gene Nametransmembrane channel-like gene family 5
Synonyms4932443L08Rik
MMRRC Submission 043341-MU
Accession Numbers

Genbank: NM_001105252.1, NM_028930.3

Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5723 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118597297-118675086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118672193 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 910 (F910I)
Ref Sequence ENSEMBL: ENSMUSP00000114137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057320] [ENSMUST00000098088] [ENSMUST00000121715] [ENSMUST00000121744]
Predicted Effect probably damaging
Transcript: ENSMUST00000057320
AA Change: F700I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049784
Gene: ENSMUSG00000030650
AA Change: F700I

DomainStartEndE-ValueType
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 275 297 N/A INTRINSIC
transmembrane domain 371 393 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
Pfam:TMC 476 581 8.1e-44 PFAM
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 652 674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098088
AA Change: F910I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095694
Gene: ENSMUSG00000030650
AA Change: F910I

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.2e-42 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121715
AA Change: F910I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112434
Gene: ENSMUSG00000030650
AA Change: F910I

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121744
AA Change: F910I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114137
Gene: ENSMUSG00000030650
AA Change: F910I

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (57/58)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,953,619 D862G possibly damaging Het
Abcg2 C T 6: 58,678,351 Q109* probably null Het
Acbd7 A G 2: 3,340,418 Y33C probably damaging Het
Actl7a A G 4: 56,744,310 D279G probably damaging Het
Akr1c18 A T 13: 4,144,329 Y110* probably null Het
Akt1 T C 12: 112,657,270 K276E probably damaging Het
Bcas2 A G 3: 103,177,292 probably benign Het
C9 T A 15: 6,486,816 Y367N probably damaging Het
Cd163 A G 6: 124,319,063 T789A probably benign Het
Cers6 T A 2: 69,108,445 S344T probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Crisp3 A C 17: 40,235,913 V38G probably damaging Het
Cyp2b23 A G 7: 26,681,396 F135L probably benign Het
Ddr2 A T 1: 169,988,520 C539* probably null Het
Efna5 T A 17: 62,607,463 D189V probably damaging Het
Endov G T 11: 119,499,849 V70F probably damaging Het
Fam49b A T 15: 63,956,598 probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem3 A T 8: 80,613,397 H773L probably benign Het
Gm43302 T A 5: 105,217,486 Q552L possibly damaging Het
Gramd1a A T 7: 31,134,483 W506R probably damaging Het
Hmcn1 C T 1: 150,694,849 V2188I possibly damaging Het
Ifit1bl2 A G 19: 34,620,058 F53L probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Krt16 A G 11: 100,248,446 Y149H probably damaging Het
Krtap5-2 A T 7: 142,175,005 C313S unknown Het
Mreg A G 1: 72,162,368 I155T probably damaging Het
Nans T C 4: 46,499,083 F130S probably benign Het
Nox4 T C 7: 87,304,973 probably benign Het
Olfr178 A T 16: 58,889,613 Y202* probably null Het
Olfr411 C A 11: 74,347,128 W32L possibly damaging Het
Olfr600 A T 7: 103,346,619 M103K possibly damaging Het
Olfr679 C A 7: 105,091,102 C179F probably damaging Het
Pkd1 A G 17: 24,565,523 T348A probably benign Het
Poteg T C 8: 27,449,992 probably null Het
Prom1 T G 5: 44,014,894 N585T probably benign Het
Rfc1 T C 5: 65,277,426 S666G probably null Het
Rilp A G 11: 75,512,861 probably benign Het
Serpina3i A G 12: 104,265,500 E132G probably benign Het
Serpina3m T C 12: 104,393,911 V414A probably damaging Het
Sfrp4 T C 13: 19,623,698 F89S probably damaging Het
Stat5a A G 11: 100,882,074 H692R probably benign Het
Tex29 A T 8: 11,854,279 probably benign Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tusc3 G A 8: 39,071,497 G230D possibly damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Upb1 A T 10: 75,428,271 I184F probably damaging Het
Vamp4 T C 1: 162,574,363 F5L possibly damaging Het
Zfp583 C A 7: 6,323,675 Q68H probably damaging Het
Zfp831 A C 2: 174,645,407 H625P probably benign Het
Zfp941 G A 7: 140,812,850 probably benign Het
Other mutations in Tmc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tmc5 APN 7 118656787 missense probably damaging 1.00
IGL01601:Tmc5 APN 7 118623824 unclassified probably benign
IGL01633:Tmc5 APN 7 118623586 missense probably damaging 0.97
IGL01845:Tmc5 APN 7 118652510 missense possibly damaging 0.93
IGL02148:Tmc5 APN 7 118645324 missense probably damaging 0.97
IGL02638:Tmc5 APN 7 118627233 missense probably benign 0.36
IGL02890:Tmc5 APN 7 118645430 splice site probably benign
F5426:Tmc5 UTSW 7 118623323 missense probably benign
PIT4802001:Tmc5 UTSW 7 118672226 missense probably benign
R0068:Tmc5 UTSW 7 118634237 missense probably benign 0.44
R0470:Tmc5 UTSW 7 118639931 missense possibly damaging 0.68
R0520:Tmc5 UTSW 7 118666576 missense probably damaging 1.00
R0786:Tmc5 UTSW 7 118627210 missense possibly damaging 0.94
R1263:Tmc5 UTSW 7 118666870 missense probably damaging 1.00
R1269:Tmc5 UTSW 7 118666593 missense probably benign 0.30
R1486:Tmc5 UTSW 7 118673432 missense probably benign 0.02
R1702:Tmc5 UTSW 7 118672239 missense probably benign 0.00
R2188:Tmc5 UTSW 7 118654955 missense probably damaging 1.00
R3508:Tmc5 UTSW 7 118645395 missense probably benign 0.01
R3893:Tmc5 UTSW 7 118645369 missense probably damaging 1.00
R3927:Tmc5 UTSW 7 118652655 nonsense probably null
R4171:Tmc5 UTSW 7 118649587 missense probably damaging 0.99
R4279:Tmc5 UTSW 7 118674663 makesense probably null
R4554:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4555:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4557:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4833:Tmc5 UTSW 7 118628829 missense probably benign 0.11
R4845:Tmc5 UTSW 7 118642381 missense probably damaging 1.00
R4852:Tmc5 UTSW 7 118645339 missense probably benign 0.32
R5087:Tmc5 UTSW 7 118645386 missense possibly damaging 0.68
R5214:Tmc5 UTSW 7 118647932 missense probably damaging 1.00
R5739:Tmc5 UTSW 7 118666611 critical splice donor site probably null
R5882:Tmc5 UTSW 7 118654919 missense probably damaging 0.99
R5946:Tmc5 UTSW 7 118670725 missense probably damaging 1.00
R6244:Tmc5 UTSW 7 118634214 missense possibly damaging 0.93
R6360:Tmc5 UTSW 7 118633966 start codon destroyed probably null 1.00
R6375:Tmc5 UTSW 7 118656814 missense probably damaging 1.00
R6458:Tmc5 UTSW 7 118645316 missense probably damaging 1.00
R6566:Tmc5 UTSW 7 118647844 missense probably damaging 1.00
R6681:Tmc5 UTSW 7 118669304 missense probably damaging 1.00
R7202:Tmc5 UTSW 7 118639956 missense possibly damaging 0.49
R7227:Tmc5 UTSW 7 118670666 missense possibly damaging 0.81
R7410:Tmc5 UTSW 7 118623597 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTTGAATCACAGATCTCAGCC -3'
(R):5'- CAGAAAATGAGGGGCCCTAC -3'

Sequencing Primer
(F):5'- GTTGAATCACAGATCTCAGCCAACAC -3'
(R):5'- CCTGGGCTATATTGCAAGAGAGTCTC -3'
Posted On2017-01-03