Incidental Mutation 'R5723:Abca8b'
ID452342
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene NameATP-binding cassette, sub-family A (ABC1), member 8b
SynonymsAbca8
MMRRC Submission 043341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5723 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109932190-109995845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109953619 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 862 (D862G)
Ref Sequence ENSEMBL: ENSMUSP00000102280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020948
AA Change: D924G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: D924G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106669
AA Change: D862G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: D862G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 C T 6: 58,678,351 Q109* probably null Het
Acbd7 A G 2: 3,340,418 Y33C probably damaging Het
Actl7a A G 4: 56,744,310 D279G probably damaging Het
Akr1c18 A T 13: 4,144,329 Y110* probably null Het
Akt1 T C 12: 112,657,270 K276E probably damaging Het
Bcas2 A G 3: 103,177,292 probably benign Het
C9 T A 15: 6,486,816 Y367N probably damaging Het
Cd163 A G 6: 124,319,063 T789A probably benign Het
Cers6 T A 2: 69,108,445 S344T probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Crisp3 A C 17: 40,235,913 V38G probably damaging Het
Cyp2b23 A G 7: 26,681,396 F135L probably benign Het
Ddr2 A T 1: 169,988,520 C539* probably null Het
Efna5 T A 17: 62,607,463 D189V probably damaging Het
Endov G T 11: 119,499,849 V70F probably damaging Het
Fam49b A T 15: 63,956,598 probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem3 A T 8: 80,613,397 H773L probably benign Het
Gm43302 T A 5: 105,217,486 Q552L possibly damaging Het
Gramd1a A T 7: 31,134,483 W506R probably damaging Het
Hmcn1 C T 1: 150,694,849 V2188I possibly damaging Het
Ifit1bl2 A G 19: 34,620,058 F53L probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Krt16 A G 11: 100,248,446 Y149H probably damaging Het
Krtap5-2 A T 7: 142,175,005 C313S unknown Het
Mreg A G 1: 72,162,368 I155T probably damaging Het
Nans T C 4: 46,499,083 F130S probably benign Het
Nox4 T C 7: 87,304,973 probably benign Het
Olfr178 A T 16: 58,889,613 Y202* probably null Het
Olfr411 C A 11: 74,347,128 W32L possibly damaging Het
Olfr600 A T 7: 103,346,619 M103K possibly damaging Het
Olfr679 C A 7: 105,091,102 C179F probably damaging Het
Pkd1 A G 17: 24,565,523 T348A probably benign Het
Poteg T C 8: 27,449,992 probably null Het
Prom1 T G 5: 44,014,894 N585T probably benign Het
Rfc1 T C 5: 65,277,426 S666G probably null Het
Rilp A G 11: 75,512,861 probably benign Het
Serpina3i A G 12: 104,265,500 E132G probably benign Het
Serpina3m T C 12: 104,393,911 V414A probably damaging Het
Sfrp4 T C 13: 19,623,698 F89S probably damaging Het
Stat5a A G 11: 100,882,074 H692R probably benign Het
Tex29 A T 8: 11,854,279 probably benign Het
Tmc5 T A 7: 118,672,193 F910I probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tusc3 G A 8: 39,071,497 G230D possibly damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Upb1 A T 10: 75,428,271 I184F probably damaging Het
Vamp4 T C 1: 162,574,363 F5L possibly damaging Het
Zfp583 C A 7: 6,323,675 Q68H probably damaging Het
Zfp831 A C 2: 174,645,407 H625P probably benign Het
Zfp941 G A 7: 140,812,850 probably benign Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 intron probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGACTGGAAGGGACCTAAGTATTTTAG -3'
(R):5'- GCTCTTCATTGCAAGATTCTAGGG -3'

Sequencing Primer
(F):5'- CTCCATTGTAGGATGGGT -3'
(R):5'- TCAGTAAACACGTTTGTTGTAGC -3'
Posted On2017-01-03