Incidental Mutation 'R5725:Sept14'
ID452433
Institutional Source Beutler Lab
Gene Symbol Sept14
Ensembl Gene ENSMUSG00000034219
Gene Nameseptin 14
Synonyms1700016K13Rik
MMRRC Submission 043343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R5725 (G1)
Quality Score186
Status Not validated
Chromosome5
Chromosomal Location129683391-129708512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129689566 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 317 (D317G)
Ref Sequence ENSEMBL: ENSMUSP00000138729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042266] [ENSMUST00000182386]
Predicted Effect probably damaging
Transcript: ENSMUST00000042266
AA Change: D318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044272
Gene: ENSMUSG00000034219
AA Change: D318G

DomainStartEndE-ValueType
Pfam:Septin 48 319 1.5e-97 PFAM
low complexity region 381 401 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182381
Predicted Effect probably damaging
Transcript: ENSMUST00000182386
AA Change: D317G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138729
Gene: ENSMUSG00000034219
AA Change: D317G

DomainStartEndE-ValueType
Pfam:Septin 48 318 3.8e-99 PFAM
low complexity region 380 400 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEPT14 is a member of the highly conserved septin family of GTP-binding cytoskeletal proteins implicated in membrane transport, apoptosis, cell polarity, cell cycle regulation, cytokinesis, and other cellular functions (Peterson et al., 2007 [PubMed 17922164]).[supplied by OMIM, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,193,319 R1301H probably benign Het
6030468B19Rik G T 11: 117,806,057 S201I probably damaging Het
Abca13 G A 11: 9,577,181 M4531I probably benign Het
Abca2 A G 2: 25,439,400 M1058V probably damaging Het
Agrn T A 4: 156,173,875 T938S probably benign Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Angptl7 C A 4: 148,496,508 A277S possibly damaging Het
Ap5z1 T C 5: 142,468,976 M244T probably damaging Het
Aplp2 T C 9: 31,157,814 D573G probably damaging Het
Arid5a G T 1: 36,319,130 E176* probably null Het
Atp8b4 A T 2: 126,433,936 N125K probably benign Het
Auts2 A G 5: 131,439,746 V911A probably benign Het
Bahcc1 G A 11: 120,274,888 R990H probably benign Het
Cd84 T C 1: 171,873,361 F230L probably benign Het
Dtnb T A 12: 3,773,566 L584H probably damaging Het
Dync2h1 A C 9: 7,169,528 S316R probably benign Het
Eif3m A G 2: 105,013,841 I73T probably damaging Het
Emilin3 A T 2: 160,908,490 C399* probably null Het
Fam118a A G 15: 85,045,621 K17E probably damaging Het
Fat4 A G 3: 38,889,625 N889S probably damaging Het
Hmcn2 G A 2: 31,383,815 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Itgax A G 7: 128,147,861 T945A possibly damaging Het
Itsn2 T A 12: 4,630,767 probably benign Het
Kcna4 A G 2: 107,296,876 T652A possibly damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrp4 A G 2: 91,494,895 Y1355C probably damaging Het
Mkl2 A T 16: 13,384,310 K146* probably null Het
Mmp9 C A 2: 164,949,336 A142E possibly damaging Het
Mpeg1 T C 19: 12,462,636 V486A probably benign Het
Mrgprb3 A T 7: 48,643,800 M1K probably null Het
Nacad T C 11: 6,601,643 E516G probably benign Het
Olfr178 G A 16: 58,889,887 T111I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa T A 4: 65,189,410 V686E probably damaging Het
Polr3a A T 14: 24,465,387 probably null Het
Ppp1r3a A G 6: 14,719,349 V522A probably benign Het
Rab6b T A 9: 103,163,862 F152I probably damaging Het
Sacs G A 14: 61,211,110 R3535Q probably damaging Het
Sin3b T C 8: 72,725,692 probably null Het
Sis G A 3: 72,965,598 P69L probably damaging Het
Slc12a3 G T 8: 94,330,446 V116L probably benign Het
Slc16a12 A T 19: 34,674,827 F306L probably damaging Het
Slc39a12 T C 2: 14,389,264 probably benign Het
Smg6 A G 11: 74,930,613 Q570R probably benign Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Srsf4 C A 4: 131,900,951 probably benign Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trav19 A C 14: 53,845,542 T25P possibly damaging Het
Trim3 A G 7: 105,617,740 probably null Het
Ugt2a2 T C 5: 87,474,896 N281S probably damaging Het
Vmn1r12 A G 6: 57,159,709 I264V probably benign Het
Vmn2r94 T A 17: 18,256,227 I403F possibly damaging Het
Zzef1 G A 11: 72,855,482 R870Q possibly damaging Het
Other mutations in Sept14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Sept14 APN 5 129683651 missense probably benign 0.26
IGL01622:Sept14 APN 5 129685955 missense probably damaging 0.99
IGL01623:Sept14 APN 5 129685955 missense probably damaging 0.99
IGL03088:Sept14 APN 5 129697733 splice site probably benign
R0658:Sept14 UTSW 5 129697908 missense probably benign 0.30
R1485:Sept14 UTSW 5 129693054 missense probably damaging 1.00
R1649:Sept14 UTSW 5 129697755 missense probably benign 0.19
R2518:Sept14 UTSW 5 129699035 missense probably benign
R2973:Sept14 UTSW 5 129699022 missense probably benign 0.42
R4679:Sept14 UTSW 5 129693026 missense possibly damaging 0.89
R4906:Sept14 UTSW 5 129692966 missense probably benign 0.39
R5004:Sept14 UTSW 5 129692976 missense possibly damaging 0.88
R5303:Sept14 UTSW 5 129689648 missense possibly damaging 0.79
R5329:Sept14 UTSW 5 129685914 critical splice donor site probably null
R5393:Sept14 UTSW 5 129683586 missense probably benign 0.01
R5542:Sept14 UTSW 5 129697862 missense probably damaging 1.00
R6750:Sept14 UTSW 5 129696117 missense probably damaging 1.00
R6796:Sept14 UTSW 5 129697758 missense probably benign 0.05
R6815:Sept14 UTSW 5 129692987 missense probably benign
R7064:Sept14 UTSW 5 129697806 missense probably benign 0.00
X0066:Sept14 UTSW 5 129689538 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTGAAGTGAGCGTGCCTTG -3'
(R):5'- CAGATGGTAGAAAGCTTATTCAGG -3'

Sequencing Primer
(F):5'- GCCTTGTTTTATGGGAGTTCTAAATG -3'
(R):5'- GGATTTGCTTCTGTCCAC -3'
Posted On2017-01-03