Incidental Mutation 'R5726:Eif2ak4'
ID452473
Institutional Source Beutler Lab
Gene Symbol Eif2ak4
Ensembl Gene ENSMUSG00000005102
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 4
SynonymsGCN2
MMRRC Submission
Accession Numbers

MGI: 1353427

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118388618-118475234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118443132 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 846 (D846G)
Ref Sequence ENSEMBL: ENSMUSP00000106498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110869] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874]
Predicted Effect probably damaging
Transcript: ENSMUST00000005233
AA Change: D924G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: D924G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 4.6e-27 PFAM
Pfam:Pkinase_Tyr 326 535 5.5e-18 PFAM
Pfam:Pkinase 589 663 1.7e-11 PFAM
Pfam:Pkinase_Tyr 589 663 1.2e-5 PFAM
low complexity region 728 738 N/A INTRINSIC
Pfam:Pkinase 781 1000 2.6e-38 PFAM
Pfam:Pkinase_Tyr 786 998 1.8e-18 PFAM
Pfam:tRNA-synt_His 1054 1380 5.7e-18 PFAM
Pfam:HGTP_anticodon2 1392 1647 5.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102527
AA Change: D812G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102
AA Change: D812G

DomainStartEndE-ValueType
coiled coil region 34 93 N/A INTRINSIC
Pfam:Pkinase 211 426 1.6e-22 PFAM
Pfam:Pkinase_Tyr 215 423 6.8e-18 PFAM
Pfam:Pkinase_Tyr 477 551 1.2e-5 PFAM
Pfam:Pkinase 477 552 3.9e-11 PFAM
low complexity region 616 626 N/A INTRINSIC
Pfam:Pkinase 647 888 9.4e-42 PFAM
Pfam:Pkinase_Tyr 672 886 1.4e-19 PFAM
Pfam:tRNA-synt_His 941 1268 4.8e-19 PFAM
Pfam:HGTP_anticodon2 1280 1535 1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110869
AA Change: D123G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106493
Gene: ENSMUSG00000005102
AA Change: D123G

DomainStartEndE-ValueType
Pfam:Pkinase 15 199 2.3e-32 PFAM
Pfam:Pkinase_Tyr 16 198 3.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110870
AA Change: D646G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102
AA Change: D646G

DomainStartEndE-ValueType
Pfam:Pkinase 45 260 3.3e-22 PFAM
Pfam:Pkinase_Tyr 47 257 1.3e-17 PFAM
Pfam:Pkinase_Tyr 311 385 2.5e-5 PFAM
Pfam:Pkinase 311 386 8e-11 PFAM
low complexity region 450 460 N/A INTRINSIC
Pfam:Pkinase 481 722 1.9e-41 PFAM
Pfam:Pkinase_Tyr 506 720 2.8e-19 PFAM
Pfam:tRNA-synt_His 775 1102 8.7e-19 PFAM
Pfam:HGTP_anticodon2 1114 1369 1.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110872
AA Change: D803G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102
AA Change: D803G

DomainStartEndE-ValueType
coiled coil region 25 84 N/A INTRINSIC
Pfam:Pkinase 202 417 3.8e-22 PFAM
Pfam:Pkinase_Tyr 206 414 1.6e-17 PFAM
Pfam:Pkinase_Tyr 468 542 2.8e-5 PFAM
Pfam:Pkinase 468 543 9.1e-11 PFAM
low complexity region 607 617 N/A INTRINSIC
Pfam:Pkinase 638 879 2.2e-41 PFAM
Pfam:Pkinase_Tyr 663 877 3.3e-19 PFAM
Pfam:tRNA-synt_His 932 1259 1.1e-18 PFAM
Pfam:HGTP_anticodon2 1271 1526 2.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110874
AA Change: D846G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: D846G

DomainStartEndE-ValueType
Pfam:RWD 8 56 6.4e-8 PFAM
coiled coil region 68 127 N/A INTRINSIC
Pfam:Pkinase 245 460 1.1e-22 PFAM
Pfam:Pkinase_Tyr 247 457 4.2e-18 PFAM
Pfam:Pkinase_Tyr 511 585 7.8e-6 PFAM
Pfam:Pkinase 511 586 2.5e-11 PFAM
low complexity region 650 660 N/A INTRINSIC
Pfam:Pkinase 681 922 6.2e-42 PFAM
Pfam:Pkinase_Tyr 706 920 9.3e-20 PFAM
Pfam:tRNA-synt_His 975 1302 3.8e-19 PFAM
Pfam:HGTP_anticodon2 1314 1569 5.4e-17 PFAM
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)
 

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Eif2ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Eif2ak4 APN 2 118464055 missense probably damaging 1.00
IGL00806:Eif2ak4 APN 2 118441166 missense probably benign 0.08
IGL01343:Eif2ak4 APN 2 118422089 missense probably benign 0.00
IGL01796:Eif2ak4 APN 2 118446304 missense probably benign 0.10
IGL02263:Eif2ak4 APN 2 118461778 missense probably benign 0.00
IGL02391:Eif2ak4 APN 2 118420791 missense probably benign 0.19
IGL02516:Eif2ak4 APN 2 118436254 missense probably damaging 1.00
IGL02603:Eif2ak4 APN 2 118450326 missense probably damaging 1.00
IGL02731:Eif2ak4 APN 2 118388814 missense probably benign
IGL02928:Eif2ak4 APN 2 118472687 critical splice donor site probably null
IGL02947:Eif2ak4 APN 2 118431033 missense probably benign 0.00
IGL03191:Eif2ak4 APN 2 118422212 missense probably damaging 1.00
IGL03202:Eif2ak4 APN 2 118400620 missense probably damaging 1.00
IGL03235:Eif2ak4 APN 2 118443140 missense probably damaging 1.00
IGL03375:Eif2ak4 APN 2 118422318 missense probably benign 0.08
atchoum UTSW 2 118400653 splice donor site
R0023:Eif2ak4 UTSW 2 118462721 missense probably damaging 1.00
R0358:Eif2ak4 UTSW 2 118463929 intron probably null
R0482:Eif2ak4 UTSW 2 118462347 missense probably damaging 1.00
R0505:Eif2ak4 UTSW 2 118431036 missense probably benign 0.01
R0523:Eif2ak4 UTSW 2 118442096 critical splice donor site probably null
R0578:Eif2ak4 UTSW 2 118474991 splice site probably benign
R0615:Eif2ak4 UTSW 2 118436185 missense probably damaging 1.00
R1300:Eif2ak4 UTSW 2 118463983 missense possibly damaging 0.79
R1531:Eif2ak4 UTSW 2 118443210 missense probably damaging 1.00
R1777:Eif2ak4 UTSW 2 118430839 missense probably damaging 0.98
R1866:Eif2ak4 UTSW 2 118472661 missense probably damaging 1.00
R1932:Eif2ak4 UTSW 2 118448486 missense probably damaging 1.00
R1977:Eif2ak4 UTSW 2 118461757 nonsense probably null
R2011:Eif2ak4 UTSW 2 118430947 missense probably damaging 1.00
R2046:Eif2ak4 UTSW 2 118451408 splice site probably benign
R2122:Eif2ak4 UTSW 2 118455793 missense probably damaging 1.00
R2125:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2126:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2193:Eif2ak4 UTSW 2 118422266 missense probably benign 0.12
R2259:Eif2ak4 UTSW 2 118455783 missense probably damaging 0.97
R2513:Eif2ak4 UTSW 2 118426583 missense probably damaging 1.00
R3798:Eif2ak4 UTSW 2 118474083 missense probably damaging 1.00
R3898:Eif2ak4 UTSW 2 118430923 missense probably damaging 1.00
R3900:Eif2ak4 UTSW 2 118475029 missense probably damaging 1.00
R4375:Eif2ak4 UTSW 2 118427924 missense probably damaging 1.00
R4423:Eif2ak4 UTSW 2 118439066 missense probably benign 0.01
R4589:Eif2ak4 UTSW 2 118417338 missense probably damaging 1.00
R4734:Eif2ak4 UTSW 2 118422087 missense probably damaging 1.00
R5173:Eif2ak4 UTSW 2 118408360 missense probably damaging 1.00
R5367:Eif2ak4 UTSW 2 118436158 splice site probably null
R5471:Eif2ak4 UTSW 2 118474132 missense probably benign 0.02
R5528:Eif2ak4 UTSW 2 118427938 missense probably damaging 1.00
R5634:Eif2ak4 UTSW 2 118462311 missense probably damaging 1.00
R5756:Eif2ak4 UTSW 2 118462740 missense possibly damaging 0.95
R5779:Eif2ak4 UTSW 2 118412963 missense possibly damaging 0.85
R5807:Eif2ak4 UTSW 2 118388851 missense probably benign
R6045:Eif2ak4 UTSW 2 118388815 nonsense probably null
R6187:Eif2ak4 UTSW 2 118457157 missense probably damaging 1.00
R6193:Eif2ak4 UTSW 2 118400600 start gained probably benign
R6468:Eif2ak4 UTSW 2 118436241 missense probably damaging 1.00
R6555:Eif2ak4 UTSW 2 118427869 missense probably damaging 0.96
R6616:Eif2ak4 UTSW 2 118454845 nonsense probably null
R6737:Eif2ak4 UTSW 2 118462268 frame shift probably null
R6956:Eif2ak4 UTSW 2 118422267 missense probably damaging 0.96
X0061:Eif2ak4 UTSW 2 118468176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAACAGCGCAAGAGACTAGATC -3'
(R):5'- AAGTCCTTGAGTTCTGATCTCC -3'

Sequencing Primer
(F):5'- CTGTGCTAGCAGATAGACATGTTAGC -3'
(R):5'- AGTTCTGATCTCCATACGACACTGAG -3'
Posted On2017-01-03