Incidental Mutation 'R5726:Sirt4'
ID452483
Institutional Source Beutler Lab
Gene Symbol Sirt4
Ensembl Gene ENSMUSG00000029524
Gene Namesirtuin 4
Synonyms4930596O17Rik
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115478010-115484725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115479646 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 317 (V317A)
Ref Sequence ENSEMBL: ENSMUSP00000107698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031495] [ENSMUST00000112066] [ENSMUST00000112067] [ENSMUST00000145785]
Predicted Effect probably benign
Transcript: ENSMUST00000031495
SMART Domains Protein: ENSMUSP00000031495
Gene: ENSMUSG00000029522

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PA2c 23 146 1.34e-66 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112066
AA Change: V317A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107697
Gene: ENSMUSG00000029524
AA Change: V317A

DomainStartEndE-ValueType
Pfam:SIR2 59 264 1.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112067
AA Change: V317A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107698
Gene: ENSMUSG00000029524
AA Change: V317A

DomainStartEndE-ValueType
Pfam:SIR2 59 264 3.7e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131121
Predicted Effect probably benign
Transcript: ENSMUST00000145785
SMART Domains Protein: ENSMUSP00000138683
Gene: ENSMUSG00000029522

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PA2c 23 76 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202822
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class IV of the sirtuin family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Sirt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Sirt4 APN 5 115479626 unclassified probably null
IGL02475:Sirt4 APN 5 115482996 missense probably benign 0.00
IGL03198:Sirt4 APN 5 115483002 missense probably benign
R0743:Sirt4 UTSW 5 115482955 missense probably benign 0.03
R2136:Sirt4 UTSW 5 115479701 missense probably benign 0.35
R3792:Sirt4 UTSW 5 115480292 missense probably benign 0.33
R3793:Sirt4 UTSW 5 115480292 missense probably benign 0.33
R4791:Sirt4 UTSW 5 115480314 missense possibly damaging 0.52
R4810:Sirt4 UTSW 5 115480449 missense probably damaging 0.99
R4818:Sirt4 UTSW 5 115479726 missense possibly damaging 0.92
R4983:Sirt4 UTSW 5 115482791 missense probably benign 0.06
R6402:Sirt4 UTSW 5 115480311 missense probably damaging 1.00
R7238:Sirt4 UTSW 5 115482990 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GAAGTTAAGGTGTCAGTGGCC -3'
(R):5'- TCTTTCCCGGGATCTAGAGC -3'

Sequencing Primer
(F):5'- GCCTATGGCCTGATCTACTGG -3'
(R):5'- CTAGAGCGATCACTGTGATTTGCC -3'
Posted On2017-01-03