Incidental Mutation 'R5726:Kl'
ID452484
Institutional Source Beutler Lab
Gene Symbol Kl
Ensembl Gene ENSMUSG00000058488
Gene Nameklotho
Synonymsalpha-kl
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150952607-150993817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150991538 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 910 (N910S)
Ref Sequence ENSEMBL: ENSMUSP00000077899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078856]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078856
AA Change: N910S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077899
Gene: ENSMUSG00000058488
AA Change: N910S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
Pfam:Glyco_hydro_1 59 380 4.3e-99 PFAM
Pfam:Glyco_hydro_1 376 508 7.9e-33 PFAM
Pfam:Glyco_hydro_1 517 955 1e-79 PFAM
transmembrane domain 984 1006 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202096
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I membrane protein that is related to beta-glucosidases. Reduced production of this protein has been observed in patients with chronic renal failure (CRF), and this may be one of the factors underlying the degenerative processes (e.g., arteriosclerosis, osteoporosis, and skin atrophy) seen in CRF. Also, mutations within this protein have been associated with ageing and bone loss. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have a short lifespan and growth retardation with one allele homeostatic imbalances and soft tissue calcification are also seen. With a second allele abnormal cancellous bone and femur morphology are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Kl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Kl APN 5 150980768 nonsense probably null
IGL00815:Kl APN 5 150980850 missense possibly damaging 0.55
IGL00840:Kl APN 5 150980787 missense possibly damaging 0.90
IGL01347:Kl APN 5 150980665 missense probably damaging 1.00
IGL01642:Kl APN 5 150980869 missense possibly damaging 0.58
IGL01774:Kl APN 5 150988483 missense probably benign 0.00
IGL01937:Kl APN 5 150988937 missense probably damaging 0.99
IGL01945:Kl APN 5 150988937 missense probably damaging 0.99
IGL02510:Kl APN 5 150989001 missense probably damaging 1.00
IGL02696:Kl APN 5 150980985 missense probably benign 0.01
IGL03028:Kl APN 5 150991550 missense probably damaging 1.00
IGL03149:Kl APN 5 150982735 nonsense probably null
ararat UTSW 5 150988853 missense possibly damaging 0.69
ararat2 UTSW 5 150988853 missense
R0480:Kl UTSW 5 150953288 missense probably damaging 1.00
R0565:Kl UTSW 5 150980944 missense possibly damaging 0.76
R0723:Kl UTSW 5 150953101 missense probably damaging 1.00
R1052:Kl UTSW 5 150982520 missense probably damaging 1.00
R1205:Kl UTSW 5 150980688 missense probably damaging 1.00
R1512:Kl UTSW 5 150988597 missense probably benign 0.00
R1529:Kl UTSW 5 150988941 missense probably benign
R1588:Kl UTSW 5 150982632 missense probably benign 0.20
R1714:Kl UTSW 5 150953333 missense probably benign 0.05
R1748:Kl UTSW 5 150980985 missense possibly damaging 0.87
R1885:Kl UTSW 5 150953494 missense possibly damaging 0.67
R1920:Kl UTSW 5 150982667 missense probably benign 0.15
R2156:Kl UTSW 5 150988960 missense probably benign 0.41
R2926:Kl UTSW 5 150953341 missense probably damaging 1.00
R4837:Kl UTSW 5 150980847 missense possibly damaging 0.90
R5221:Kl UTSW 5 150989151 missense probably damaging 1.00
R5687:Kl UTSW 5 150988466 missense possibly damaging 0.84
R5727:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5735:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5797:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5933:Kl UTSW 5 150989483 missense probably damaging 1.00
R6075:Kl UTSW 5 150953001 missense probably damaging 1.00
R6076:Kl UTSW 5 150953001 missense probably damaging 1.00
R6077:Kl UTSW 5 150953001 missense probably damaging 1.00
R6149:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6150:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6151:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6158:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6236:Kl UTSW 5 150953290 missense probably damaging 1.00
R6609:Kl UTSW 5 150988962 missense probably benign 0.00
X0066:Kl UTSW 5 150991615 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGGTGTGAAATCTTTCCCGG -3'
(R):5'- AGCAAAGACTTCCGGGTTTG -3'

Sequencing Primer
(F):5'- CCCGGTGAAATCTGATGAGTCTC -3'
(R):5'- ACATTCGGTGCACACAGTG -3'
Posted On2017-01-03