Incidental Mutation 'R5726:Arhgap25'
ID452487
Institutional Source Beutler Lab
Gene Symbol Arhgap25
Ensembl Gene ENSMUSG00000030047
Gene NameRho GTPase activating protein 25
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87458545-87533259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87463459 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 402 (S402N)
Ref Sequence ENSEMBL: ENSMUSP00000109267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071024] [ENSMUST00000101197] [ENSMUST00000113637]
Predicted Effect probably benign
Transcript: ENSMUST00000071024
AA Change: S313N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068964
Gene: ENSMUSG00000030047
AA Change: S313N

DomainStartEndE-ValueType
PDB:1V89|A 1 63 7e-33 PDB
Blast:RhoGAP 16 66 9e-22 BLAST
RhoGAP 86 262 6.28e-64 SMART
coiled coil region 454 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101197
AA Change: S376N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098758
Gene: ENSMUSG00000030047
AA Change: S376N

DomainStartEndE-ValueType
PH 21 127 2.11e-21 SMART
RhoGAP 149 325 6.28e-64 SMART
coiled coil region 517 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113637
AA Change: S402N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109267
Gene: ENSMUSG00000030047
AA Change: S402N

DomainStartEndE-ValueType
PH 47 153 2.11e-21 SMART
RhoGAP 175 351 6.28e-64 SMART
coiled coil region 543 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203559
Meta Mutation Damage Score 0.006 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAPs, such as ARHGAP25, encode negative regulators of Rho GTPases (see ARHA; MIM 165390), which are implicated in actin remodeling, cell polarity, and cell migration (Katoh and Katoh, 2004 [PubMed 15254788]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered leukocyte transendothelial migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Arhgap25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01454:Arhgap25 APN 6 87496076 missense possibly damaging 0.92
IGL02112:Arhgap25 APN 6 87467937 missense possibly damaging 0.80
IGL03051:Arhgap25 APN 6 87495914 missense probably null 1.00
R0462:Arhgap25 UTSW 6 87459960 missense possibly damaging 0.88
R1636:Arhgap25 UTSW 6 87495941 missense probably damaging 1.00
R1777:Arhgap25 UTSW 6 87463307 missense probably benign 0.41
R2077:Arhgap25 UTSW 6 87460008 missense probably damaging 1.00
R2845:Arhgap25 UTSW 6 87459967 missense possibly damaging 0.86
R4091:Arhgap25 UTSW 6 87463035 missense probably benign
R4435:Arhgap25 UTSW 6 87462938 missense possibly damaging 0.56
R4773:Arhgap25 UTSW 6 87496071 missense probably benign
R5121:Arhgap25 UTSW 6 87532864 missense probably benign 0.01
R5169:Arhgap25 UTSW 6 87463270 missense possibly damaging 0.93
R5334:Arhgap25 UTSW 6 87463261 missense possibly damaging 0.77
R6696:Arhgap25 UTSW 6 87465651 missense probably damaging 1.00
R6696:Arhgap25 UTSW 6 87466563 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTGAAGATGGAGACCAGAACTC -3'
(R):5'- TGGCTAGAGTCCCTGAACTG -3'

Sequencing Primer
(F):5'- TGGAGACCAGAACTCATTTTTAAAG -3'
(R):5'- GGCTAGAGTCCCTGAACTGTAATATC -3'
Posted On2017-01-03