Incidental Mutation 'R5726:Myh14'
ID452490
Institutional Source Beutler Lab
Gene Symbol Myh14
Ensembl Gene ENSMUSG00000030739
Gene Namemyosin, heavy polypeptide 14
SynonymsNMHC II-C, 2400004E04Rik
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44605803-44670843 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 44643462 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000048102] [ENSMUST00000107899] [ENSMUST00000107900] [ENSMUST00000207775]
Predicted Effect probably null
Transcript: ENSMUST00000048102
SMART Domains Protein: ENSMUSP00000046059
Gene: ENSMUSG00000030739

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Blast:MYSc 839 872 1e-12 BLAST
low complexity region 880 891 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1005 1013 N/A INTRINSIC
low complexity region 1021 1029 N/A INTRINSIC
low complexity region 1030 1041 N/A INTRINSIC
Pfam:Myosin_tail_1 1094 1951 9.3e-180 PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107899
SMART Domains Protein: ENSMUSP00000103531
Gene: ENSMUSG00000030739

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 797 N/A SMART
IQ 798 820 3.91e-4 SMART
Blast:MYSc 831 864 1e-12 BLAST
low complexity region 872 883 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 997 1005 N/A INTRINSIC
low complexity region 1013 1021 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Pfam:Myosin_tail_1 1086 1943 9e-180 PFAM
low complexity region 1947 1958 N/A INTRINSIC
low complexity region 1960 1989 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107900
SMART Domains Protein: ENSMUSP00000103532
Gene: ENSMUSG00000030739

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Pfam:Myosin_tail_1 869 1949 N/A PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182648
SMART Domains Protein: ENSMUSP00000138739
Gene: ENSMUSG00000030739

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 838 N/A SMART
IQ 839 861 3.91e-4 SMART
Blast:MYSc 872 905 1e-12 BLAST
low complexity region 913 924 N/A INTRINSIC
low complexity region 959 970 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
Pfam:Myosin_tail_1 1127 1984 9.1e-180 PFAM
low complexity region 1988 1999 N/A INTRINSIC
low complexity region 2001 2030 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207775
Predicted Effect probably null
Transcript: ENSMUST00000208200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209087
Meta Mutation Damage Score 0.57 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-14 (MYO14). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene result in one form of autosomal dominant hearing impairment. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and survive to adulthood with no apparent defects. About 30% of knock-in mice either heterozygous or homozygous for a single amino acid mutation exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Myh14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Myh14 APN 7 44606292 unclassified probably benign
IGL01431:Myh14 APN 7 44614358 missense probably null 0.00
IGL01722:Myh14 APN 7 44643532 missense probably damaging 1.00
IGL01806:Myh14 APN 7 44657939 missense probably benign 0.19
IGL02034:Myh14 APN 7 44616293 missense possibly damaging 0.58
IGL02260:Myh14 APN 7 44611571 missense probably damaging 1.00
IGL02590:Myh14 APN 7 44624079 missense probably damaging 1.00
IGL02696:Myh14 APN 7 44665106 missense probably damaging 1.00
IGL02705:Myh14 APN 7 44608536 missense possibly damaging 0.66
IGL03193:Myh14 APN 7 44629945 missense possibly damaging 0.91
PIT4581001:Myh14 UTSW 7 44613482 missense probably benign 0.04
R0067:Myh14 UTSW 7 44623127 missense probably benign 0.05
R0083:Myh14 UTSW 7 44634519 missense probably damaging 0.98
R0108:Myh14 UTSW 7 44634519 missense probably damaging 0.98
R0152:Myh14 UTSW 7 44623181 missense probably damaging 1.00
R0369:Myh14 UTSW 7 44660950 missense probably damaging 1.00
R0552:Myh14 UTSW 7 44613681 missense probably damaging 1.00
R0699:Myh14 UTSW 7 44624971 missense possibly damaging 0.67
R0763:Myh14 UTSW 7 44665367 missense probably damaging 0.98
R1079:Myh14 UTSW 7 44630002 missense probably damaging 1.00
R1388:Myh14 UTSW 7 44665122 missense probably damaging 0.98
R1432:Myh14 UTSW 7 44616299 missense probably damaging 1.00
R1568:Myh14 UTSW 7 44611698 nonsense probably null
R1579:Myh14 UTSW 7 44655694 splice site probably null
R1598:Myh14 UTSW 7 44638394 missense probably damaging 0.96
R1848:Myh14 UTSW 7 44632429 missense probably damaging 0.98
R1869:Myh14 UTSW 7 44611643 missense possibly damaging 0.95
R1917:Myh14 UTSW 7 44657925 missense probably benign
R1933:Myh14 UTSW 7 44615348 missense probably benign 0.09
R1984:Myh14 UTSW 7 44639022 missense probably damaging 1.00
R2154:Myh14 UTSW 7 44652429 critical splice donor site probably null
R2190:Myh14 UTSW 7 44661063 missense probably damaging 1.00
R2217:Myh14 UTSW 7 44634376 missense probably damaging 1.00
R2239:Myh14 UTSW 7 44665183 missense probably damaging 1.00
R2918:Myh14 UTSW 7 44616263 missense possibly damaging 0.91
R4091:Myh14 UTSW 7 44632991 missense possibly damaging 0.93
R4110:Myh14 UTSW 7 44628550 missense probably benign 0.00
R4199:Myh14 UTSW 7 44615503 nonsense probably null
R4507:Myh14 UTSW 7 44629991 missense probably benign 0.00
R4539:Myh14 UTSW 7 44627054 missense probably damaging 1.00
R4550:Myh14 UTSW 7 44634433 missense probably damaging 1.00
R4673:Myh14 UTSW 7 44624330 missense probably damaging 1.00
R4768:Myh14 UTSW 7 44613675 missense probably benign 0.19
R4832:Myh14 UTSW 7 44625142 missense probably benign 0.31
R4853:Myh14 UTSW 7 44608448 missense probably damaging 1.00
R4901:Myh14 UTSW 7 44661040 missense possibly damaging 0.94
R4928:Myh14 UTSW 7 44635502 missense probably benign 0.00
R5070:Myh14 UTSW 7 44616248 missense possibly damaging 0.91
R5166:Myh14 UTSW 7 44628855 missense probably damaging 0.99
R5786:Myh14 UTSW 7 44613463 missense probably benign 0.23
R5895:Myh14 UTSW 7 44606709 missense probably damaging 1.00
R5961:Myh14 UTSW 7 44623094 missense probably damaging 0.96
R6014:Myh14 UTSW 7 44625078 missense probably null
R6080:Myh14 UTSW 7 44655611 missense probably damaging 1.00
R6187:Myh14 UTSW 7 44627033 missense probably damaging 1.00
R6657:Myh14 UTSW 7 44637846 missense probably damaging 1.00
R6833:Myh14 UTSW 7 44624379 nonsense probably null
R6894:Myh14 UTSW 7 44633512 missense probably damaging 1.00
R6916:Myh14 UTSW 7 44629313 missense probably damaging 0.96
R6962:Myh14 UTSW 7 44657939 missense probably benign 0.36
R7066:Myh14 UTSW 7 44630755 missense possibly damaging 0.69
R7261:Myh14 UTSW 7 44624337 nonsense probably null
R7303:Myh14 UTSW 7 44611701 missense probably damaging 1.00
R7304:Myh14 UTSW 7 44629991 missense probably benign 0.00
X0026:Myh14 UTSW 7 44614394 missense probably benign 0.00
X0063:Myh14 UTSW 7 44624133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGCTGTCTACCTATCATG -3'
(R):5'- TGCAGTTTGAAAGGCTTAGCTG -3'

Sequencing Primer
(F):5'- GCTGTCTACCTATCATGGTGGG -3'
(R):5'- CTCTGGGGTACTGGACATGAC -3'
Posted On2017-01-03