Incidental Mutation 'R5726:Cln3'
ID452492
Institutional Source Beutler Lab
Gene Symbol Cln3
Ensembl Gene ENSMUSG00000030720
Gene Nameceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease)
Synonymsbattenin
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126571207-126585817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126575501 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 276 (T276A)
Ref Sequence ENSEMBL: ENSMUSP00000111973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032962] [ENSMUST00000084589] [ENSMUST00000098036] [ENSMUST00000116269] [ENSMUST00000125508] [ENSMUST00000128970] [ENSMUST00000150917]
Predicted Effect probably null
Transcript: ENSMUST00000032962
AA Change: T276A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032962
Gene: ENSMUSG00000030720
AA Change: T276A

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084589
AA Change: T276A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081636
Gene: ENSMUSG00000030720
AA Change: T276A

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098036
AA Change: T252A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095644
Gene: ENSMUSG00000030720
AA Change: T252A

DomainStartEndE-ValueType
Pfam:CLN3 37 414 4.3e-191 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116269
AA Change: T276A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111973
Gene: ENSMUSG00000030720
AA Change: T276A

DomainStartEndE-ValueType
Pfam:CLN3 39 437 1.6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124177
Predicted Effect probably null
Transcript: ENSMUST00000125508
SMART Domains Protein: ENSMUSP00000117561
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 76 1.2e-17 PFAM
Pfam:CLN3 73 151 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128225
Predicted Effect probably null
Transcript: ENSMUST00000128970
SMART Domains Protein: ENSMUSP00000114901
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 196 1.2e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139766
Predicted Effect probably benign
Transcript: ENSMUST00000150917
SMART Domains Protein: ENSMUSP00000138688
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 77 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184825
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein called battenin that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis genes, cause a number of neurodegenerative diseases collectively known as neuronal ceroid lipofuscinoses, the most common of which is juvenile neuronal ceroid-lipofuscinosis (Batten disease). Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Nullizygous mutations can result in neuronal ceroid lipofuscinosis, degeneration of the retina, cerebral cortex and cerebellum, hypertrophy of hippocampal interneuron populations, gliosis, neurological deficits, and premature death. Homozygotes for a null allele show impaired water and K+ balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Cln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Cln3 APN 7 126575254 missense probably damaging 1.00
IGL01603:Cln3 APN 7 126575354 missense probably benign 0.30
IGL02216:Cln3 APN 7 126575342 critical splice donor site probably null
IGL02440:Cln3 APN 7 126582782 missense probably benign 0.01
IGL03118:Cln3 APN 7 126575397 missense probably null 0.00
R0326:Cln3 UTSW 7 126583045 start codon destroyed probably damaging 0.96
R0610:Cln3 UTSW 7 126580189 missense probably damaging 1.00
R1256:Cln3 UTSW 7 126583036 missense probably damaging 0.98
R2136:Cln3 UTSW 7 126582799 missense probably benign 0.00
R2202:Cln3 UTSW 7 126579218 missense probably benign 0.11
R3977:Cln3 UTSW 7 126580136 splice site probably benign
R4563:Cln3 UTSW 7 126572558 missense probably damaging 0.98
R4690:Cln3 UTSW 7 126575393 missense possibly damaging 0.61
R4936:Cln3 UTSW 7 126575221 missense probably damaging 1.00
R5668:Cln3 UTSW 7 126572386 missense probably benign 0.01
R6385:Cln3 UTSW 7 126575035 missense probably null 1.00
R6591:Cln3 UTSW 7 126579434 missense possibly damaging 0.82
R6691:Cln3 UTSW 7 126579434 missense possibly damaging 0.82
R6891:Cln3 UTSW 7 126582803 missense possibly damaging 0.88
R7173:Cln3 UTSW 7 126579417 missense probably damaging 1.00
R7214:Cln3 UTSW 7 126582770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGAGCTCGAACTGCAG -3'
(R):5'- GCTGTACCCTGATCTATAGTCTTGC -3'

Sequencing Primer
(F):5'- GCTCGAACTGCAGCGAAGAC -3'
(R):5'- GTATACAGCGCGAAGTTTACC -3'
Posted On2017-01-03