Incidental Mutation 'R5726:Btn1a1'
ID452514
Institutional Source Beutler Lab
Gene Symbol Btn1a1
Ensembl Gene ENSMUSG00000000706
Gene Namebutyrophilin, subfamily 1, member A1
SynonymsBtn
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23456992-23465901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23459352 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 309 (D309V)
Ref Sequence ENSEMBL: ENSMUSP00000041013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041674] [ENSMUST00000110434]
Predicted Effect probably damaging
Transcript: ENSMUST00000041674
AA Change: D309V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041013
Gene: ENSMUSG00000000706
AA Change: D309V

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
IGv 46 127 1.97e-11 SMART
IG_like 150 237 9.03e1 SMART
transmembrane domain 246 268 N/A INTRINSIC
PRY 303 355 2.64e-27 SMART
SPRY 356 477 1.46e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110434
SMART Domains Protein: ENSMUSP00000106064
Gene: ENSMUSG00000000706

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
IGv 46 127 1.97e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225831
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. It is a member of the immunoglobulin superfamily. It may have a cell surface receptor function. The human butyrophilin gene is localized in the major histocompatibility complex (MHC) class I region of 6p and may have arisen relatively recently in evolution by the shuffling of exons between 2 ancestral gene families [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired lactation and abnormal lipid accumulation in the mammary gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Btn1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Btn1a1 APN 13 23461737 missense possibly damaging 0.56
IGL01608:Btn1a1 APN 13 23461608 missense probably benign 0.00
IGL02538:Btn1a1 APN 13 23459215 missense possibly damaging 0.50
IGL02795:Btn1a1 APN 13 23460616 critical splice acceptor site probably null
IGL02933:Btn1a1 APN 13 23460527 missense possibly damaging 0.63
R0063:Btn1a1 UTSW 13 23465097 splice site probably null
R0855:Btn1a1 UTSW 13 23464319 missense probably damaging 1.00
R1754:Btn1a1 UTSW 13 23460468 missense probably benign 0.01
R2122:Btn1a1 UTSW 13 23461521 missense probably damaging 1.00
R3110:Btn1a1 UTSW 13 23461551 missense possibly damaging 0.67
R3112:Btn1a1 UTSW 13 23461551 missense possibly damaging 0.67
R3941:Btn1a1 UTSW 13 23459264 missense probably benign 0.01
R4169:Btn1a1 UTSW 13 23465155 missense probably benign
R4924:Btn1a1 UTSW 13 23464226 splice site probably benign
R4927:Btn1a1 UTSW 13 23460624 splice site probably null
R5255:Btn1a1 UTSW 13 23464154 intron probably benign
R5554:Btn1a1 UTSW 13 23459125 missense possibly damaging 0.55
R6228:Btn1a1 UTSW 13 23464351 missense probably damaging 0.98
R6664:Btn1a1 UTSW 13 23459320 missense probably benign 0.00
R7117:Btn1a1 UTSW 13 23459245 missense possibly damaging 0.91
R7150:Btn1a1 UTSW 13 23459351 missense probably damaging 1.00
R7151:Btn1a1 UTSW 13 23459313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGTCATGGGGTCAAAC -3'
(R):5'- TGCCAGTAAGAGATTGGGGC -3'

Sequencing Primer
(F):5'- AATGGCCCAGTCAGTTCTATC -3'
(R):5'- CTAGAGAGAAGGACTGCTAGTGAGTG -3'
Posted On2017-01-03