Incidental Mutation 'R5726:Tsc22d1'
ID452519
Institutional Source Beutler Lab
Gene Symbol Tsc22d1
Ensembl Gene ENSMUSG00000022010
Gene NameTSC22 domain family, member 1
SynonymsTSC-22, Tgfb1i4, Egr5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location76414961-76507765 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 76505317 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 65 (L65*)
Ref Sequence ENSEMBL: ENSMUSP00000135146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022587] [ENSMUST00000048371] [ENSMUST00000101618] [ENSMUST00000110888] [ENSMUST00000133224] [ENSMUST00000134109] [ENSMUST00000140251] [ENSMUST00000142683] [ENSMUST00000177207]
Predicted Effect probably benign
Transcript: ENSMUST00000022587
SMART Domains Protein: ENSMUSP00000022587
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
Pfam:TSC22 58 117 3.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048371
SMART Domains Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 461 489 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
low complexity region 537 556 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 673 687 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 933 970 N/A INTRINSIC
Pfam:TSC22 992 1048 7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101618
SMART Domains Protein: ENSMUSP00000099140
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
Pfam:TSC22 22 81 1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110888
SMART Domains Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
low complexity region 59 96 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 191 208 N/A INTRINSIC
low complexity region 216 241 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
low complexity region 266 289 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 415 439 N/A INTRINSIC
low complexity region 455 474 N/A INTRINSIC
internal_repeat_1 502 536 8.43e-5 PROSPERO
low complexity region 537 555 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
internal_repeat_1 644 676 8.43e-5 PROSPERO
low complexity region 851 888 N/A INTRINSIC
Pfam:TSC22 910 969 4.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133224
SMART Domains Protein: ENSMUSP00000135561
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134109
AA Change: L65*
Predicted Effect probably benign
Transcript: ENSMUST00000140251
SMART Domains Protein: ENSMUSP00000135806
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142683
SMART Domains Protein: ENSMUSP00000135493
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177207
SMART Domains Protein: ENSMUSP00000135296
Gene: ENSMUSG00000022010

DomainStartEndE-ValueType
Pfam:TSC22 1 60 1.3e-35 PFAM
Meta Mutation Damage Score 0.6432 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Tsc22d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tsc22d1 APN 14 76418917 missense probably damaging 0.99
IGL00515:Tsc22d1 APN 14 76418477 missense probably damaging 0.99
IGL00703:Tsc22d1 APN 14 76504828 missense possibly damaging 0.62
IGL00974:Tsc22d1 APN 14 76506442 missense probably damaging 1.00
IGL01015:Tsc22d1 APN 14 76418741 missense possibly damaging 0.66
IGL01515:Tsc22d1 APN 14 76505299 critical splice donor site probably null
IGL02172:Tsc22d1 APN 14 76417692 missense probably benign 0.04
IGL02307:Tsc22d1 APN 14 76416461 missense probably damaging 0.99
IGL02553:Tsc22d1 APN 14 76417398 missense possibly damaging 0.73
IGL02870:Tsc22d1 APN 14 76417617 missense probably benign 0.42
IGL02989:Tsc22d1 APN 14 76418901 missense probably benign 0.05
IGL03216:Tsc22d1 APN 14 76418637 missense probably benign 0.02
R0127:Tsc22d1 UTSW 14 76418981 missense possibly damaging 0.92
R0416:Tsc22d1 UTSW 14 76505303 splice site probably benign
R0854:Tsc22d1 UTSW 14 76418201 nonsense probably null
R0963:Tsc22d1 UTSW 14 76418599 missense possibly damaging 0.92
R1370:Tsc22d1 UTSW 14 76437664 intron probably benign
R1736:Tsc22d1 UTSW 14 76418357 missense probably benign 0.08
R1751:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R1760:Tsc22d1 UTSW 14 76416948 missense possibly damaging 0.69
R1767:Tsc22d1 UTSW 14 76418102 missense probably damaging 0.98
R2020:Tsc22d1 UTSW 14 76418333 missense probably damaging 1.00
R2209:Tsc22d1 UTSW 14 76418740 missense probably damaging 1.00
R2439:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R2471:Tsc22d1 UTSW 14 76418204 missense probably benign 0.00
R3114:Tsc22d1 UTSW 14 76417337 missense probably damaging 1.00
R3907:Tsc22d1 UTSW 14 76416543 missense probably damaging 0.98
R3973:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3974:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3975:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R3976:Tsc22d1 UTSW 14 76418609 missense probably damaging 1.00
R4292:Tsc22d1 UTSW 14 76418880 missense probably benign 0.12
R4612:Tsc22d1 UTSW 14 76419005 missense possibly damaging 0.66
R4806:Tsc22d1 UTSW 14 76416988 splice site probably null
R4980:Tsc22d1 UTSW 14 76418256 missense probably benign 0.02
R5068:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5070:Tsc22d1 UTSW 14 76418310 missense probably benign 0.44
R5239:Tsc22d1 UTSW 14 76418412 missense probably damaging 0.99
R5360:Tsc22d1 UTSW 14 76417267 unclassified probably benign
R5400:Tsc22d1 UTSW 14 76417054 missense probably benign 0.00
R5616:Tsc22d1 UTSW 14 76416217 unclassified probably benign
R5934:Tsc22d1 UTSW 14 76418826 missense possibly damaging 0.87
R6860:Tsc22d1 UTSW 14 76418292 missense possibly damaging 0.73
R6904:Tsc22d1 UTSW 14 76506483 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGATGCTAGTAACGTCATTCG -3'
(R):5'- AAAGCCACACTGCTGAAGGTG -3'

Sequencing Primer
(F):5'- CGTCATTCGAATTCAGAGATCTGTC -3'
(R):5'- TGAAGGTGCTCCCAAGACCAG -3'
Posted On2017-01-03