Incidental Mutation 'R5726:Slc12a2'
ID452532
Institutional Source Beutler Lab
Gene Symbol Slc12a2
Ensembl Gene ENSMUSG00000024597
Gene Namesolute carrier family 12, member 2
SynonymsNkcc1, sy-ns, mBSC2, sodium/potassium/chloride cotransporters
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location57878678-57946821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57896354 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 271 (A271S)
Ref Sequence ENSEMBL: ENSMUSP00000111023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115366]
Predicted Effect probably benign
Transcript: ENSMUST00000115366
AA Change: A271S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597
AA Change: A271S

DomainStartEndE-ValueType
low complexity region 3 33 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
SCOP:d1gkub1 91 122 4e-3 SMART
low complexity region 141 162 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
Pfam:AA_permease_N 196 260 5.9e-29 PFAM
Pfam:AA_permease 284 787 4.1e-154 PFAM
Pfam:AA_permease_2 290 743 8.7e-22 PFAM
Pfam:SLC12 795 1206 2.7e-167 PFAM
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Slc12a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Slc12a2 APN 18 57936405 missense probably damaging 1.00
IGL01099:Slc12a2 APN 18 57906020 nonsense probably null
IGL01896:Slc12a2 APN 18 57896308 missense probably benign 0.06
IGL02266:Slc12a2 APN 18 57912020 splice site probably benign
IGL02489:Slc12a2 APN 18 57912002 missense probably damaging 0.98
IGL02681:Slc12a2 APN 18 57879399 missense probably benign 0.25
IGL03068:Slc12a2 APN 18 57904335 splice site probably benign
IGL03076:Slc12a2 APN 18 57926397 splice site probably benign
IGL03086:Slc12a2 APN 18 57921784 missense probably benign 0.00
IGL03238:Slc12a2 APN 18 57914234 missense possibly damaging 0.85
frankie UTSW 18 57934963 missense possibly damaging 0.48
sugar UTSW 18 57899272 missense probably damaging 1.00
R0048:Slc12a2 UTSW 18 57915522 splice site probably benign
R0194:Slc12a2 UTSW 18 57930211 missense probably damaging 1.00
R0530:Slc12a2 UTSW 18 57919536 missense possibly damaging 0.76
R0959:Slc12a2 UTSW 18 57904378 missense probably damaging 1.00
R1014:Slc12a2 UTSW 18 57921810 missense probably benign 0.00
R1112:Slc12a2 UTSW 18 57937752 missense probably benign 0.01
R1544:Slc12a2 UTSW 18 57879302 missense probably benign 0.00
R1669:Slc12a2 UTSW 18 57904235 missense probably damaging 0.99
R1935:Slc12a2 UTSW 18 57904353 missense possibly damaging 0.95
R1951:Slc12a2 UTSW 18 57879395 missense possibly damaging 0.51
R1990:Slc12a2 UTSW 18 57910286 missense possibly damaging 0.61
R2340:Slc12a2 UTSW 18 57900050 missense probably benign 0.03
R3971:Slc12a2 UTSW 18 57930196 missense possibly damaging 0.84
R4120:Slc12a2 UTSW 18 57899355 missense possibly damaging 0.95
R4223:Slc12a2 UTSW 18 57910256 missense probably damaging 1.00
R4541:Slc12a2 UTSW 18 57912965 intron probably null
R4678:Slc12a2 UTSW 18 57905960 nonsense probably null
R4931:Slc12a2 UTSW 18 57934963 missense possibly damaging 0.48
R5114:Slc12a2 UTSW 18 57899272 missense probably damaging 1.00
R5226:Slc12a2 UTSW 18 57879020 missense probably damaging 1.00
R5648:Slc12a2 UTSW 18 57896310 missense possibly damaging 0.83
R5789:Slc12a2 UTSW 18 57912019 splice site probably null
R5868:Slc12a2 UTSW 18 57943996 missense probably damaging 1.00
R5921:Slc12a2 UTSW 18 57932523 missense probably benign 0.06
R6126:Slc12a2 UTSW 18 57944044 missense possibly damaging 0.94
R6310:Slc12a2 UTSW 18 57915506 missense probably damaging 0.99
R6598:Slc12a2 UTSW 18 57898073 missense probably benign 0.01
R6615:Slc12a2 UTSW 18 57898128 missense probably damaging 1.00
R6911:Slc12a2 UTSW 18 57919469 missense probably benign 0.05
R6957:Slc12a2 UTSW 18 57910272 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGTCACGTCACTCTTGGAAG -3'
(R):5'- GGCCTTCCATAGTACTCACAAGC -3'

Sequencing Primer
(F):5'- TTGCTGGACATTGAACCCAG -3'
(R):5'- CTTCCATAGTACTCACAAGCAAATTG -3'
Posted On2017-01-03