Incidental Mutation 'R5727:Cpxm1'
ID452544
Institutional Source Beutler Lab
Gene Symbol Cpxm1
Ensembl Gene ENSMUSG00000027408
Gene Namecarboxypeptidase X 1 (M14 family)
SynonymsCpx-1
MMRRC Submission 043190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R5727 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130390775-130397574 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 130390963 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 704 (R704*)
Ref Sequence ENSEMBL: ENSMUSP00000028897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028897]
Predicted Effect probably null
Transcript: ENSMUST00000028897
AA Change: R704*
SMART Domains Protein: ENSMUSP00000028897
Gene: ENSMUSG00000027408
AA Change: R704*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
FA58C 104 263 1.44e-28 SMART
Zn_pept 410 699 5.77e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130533
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the carboxypeptidase family of proteins. Cloning of a comparable locus in mouse indicates that the encoded protein contains a discoidin domain and a carboxypeptidase domain, but the protein appears to lack residues necessary for carboxypeptidase activity.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C A 14: 29,990,881 L494M probably benign Het
Ahnak G T 19: 9,016,747 A5132S probably damaging Het
Cadps G A 14: 12,486,525 Q882* probably null Het
Cdhr2 G A 13: 54,724,308 V662M possibly damaging Het
Cdyl2 T A 8: 116,583,168 I350F probably damaging Het
Cfap44 T G 16: 44,435,442 F966V probably damaging Het
Dnah11 A T 12: 118,127,106 F1034L probably damaging Het
Dpep2 A G 8: 105,986,443 V440A probably benign Het
Ehmt2 A T 17: 34,906,032 M11L possibly damaging Het
Eml2 C T 7: 19,190,760 H185Y probably damaging Het
Gm10845 T A 14: 79,863,330 noncoding transcript Het
Gm8122 T G 14: 43,234,020 N97T unknown Het
Gnb1 A G 4: 155,555,102 T263A probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ier5l A G 2: 30,473,159 C285R possibly damaging Het
Kif21b A G 1: 136,170,009 N1336D probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lama1 A G 17: 67,815,224 H2722R possibly damaging Het
Mdm2 A G 10: 117,702,307 M13T possibly damaging Het
Micall1 T A 15: 79,130,478 Y685N possibly damaging Het
Mthfd1l T G 10: 4,103,302 S884A possibly damaging Het
Nkiras2 A G 11: 100,625,027 Y60C probably damaging Het
Oc90 T G 15: 65,881,539 R342S possibly damaging Het
Olfr1181 T A 2: 88,423,447 I193F probably benign Het
Olfr12 A G 1: 92,620,178 N91D probably benign Het
Olfr1277 T A 2: 111,269,852 R172* probably null Het
Olfr350 T C 2: 36,850,532 L162P possibly damaging Het
Olfr748 C A 14: 50,710,360 T10K possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 G T 16: 35,964,097 E507* probably null Het
Pex13 A G 11: 23,655,705 I175T probably benign Het
Phf12 A G 11: 78,023,544 E604G probably damaging Het
Ppfia4 A T 1: 134,324,077 probably null Het
Rragc T C 4: 123,920,035 Y141H possibly damaging Het
Slc35g3 A G 11: 69,760,454 V257A probably benign Het
Snx5 T C 2: 144,260,754 T80A probably benign Het
Sorcs2 G A 5: 36,031,286 A826V possibly damaging Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Tmem161b T A 13: 84,286,790 S302R possibly damaging Het
Ube2o A T 11: 116,539,670 F1081I probably damaging Het
Vmn2r2 T C 3: 64,117,187 I658V probably benign Het
Vwa3b T G 1: 37,135,519 L672V probably benign Het
Wscd2 T C 5: 113,577,350 F417S possibly damaging Het
Other mutations in Cpxm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cpxm1 APN 2 130395943 missense probably damaging 1.00
IGL01327:Cpxm1 APN 2 130396357 missense probably benign 0.00
IGL01373:Cpxm1 APN 2 130394135 missense probably damaging 1.00
IGL01622:Cpxm1 APN 2 130391271 missense probably benign 0.00
IGL01623:Cpxm1 APN 2 130391271 missense probably benign 0.00
IGL01981:Cpxm1 APN 2 130394140 nonsense probably null
IGL02031:Cpxm1 APN 2 130393681 missense probably damaging 1.00
IGL02369:Cpxm1 APN 2 130396424 missense probably damaging 1.00
IGL03057:Cpxm1 APN 2 130393189 missense probably damaging 1.00
R0316:Cpxm1 UTSW 2 130393171 missense probably damaging 1.00
R0544:Cpxm1 UTSW 2 130393135 missense probably damaging 1.00
R0726:Cpxm1 UTSW 2 130390939 missense probably damaging 0.96
R0944:Cpxm1 UTSW 2 130397503 missense probably damaging 1.00
R1334:Cpxm1 UTSW 2 130393563 missense probably damaging 0.99
R1366:Cpxm1 UTSW 2 130396122 missense probably damaging 1.00
R1429:Cpxm1 UTSW 2 130396444 missense probably damaging 0.98
R1654:Cpxm1 UTSW 2 130393546 missense possibly damaging 0.51
R1824:Cpxm1 UTSW 2 130395697 missense probably damaging 0.99
R2144:Cpxm1 UTSW 2 130397410 missense probably benign 0.00
R2200:Cpxm1 UTSW 2 130393197 missense probably damaging 1.00
R2320:Cpxm1 UTSW 2 130394211 missense probably damaging 1.00
R2434:Cpxm1 UTSW 2 130394084 missense probably damaging 1.00
R3118:Cpxm1 UTSW 2 130393573 missense possibly damaging 0.80
R4601:Cpxm1 UTSW 2 130393576 missense possibly damaging 0.83
R5020:Cpxm1 UTSW 2 130395977 splice site probably null
R5041:Cpxm1 UTSW 2 130394070 missense probably damaging 1.00
R5806:Cpxm1 UTSW 2 130397473 missense probably damaging 1.00
R6660:Cpxm1 UTSW 2 130396149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTTTAATGAGCCAGAGCAC -3'
(R):5'- GAAGATCCTTGAACCCTGCC -3'

Sequencing Primer
(F):5'- TTAATGAGCCAGAGCACCTCTTC -3'
(R):5'- GAACCCTGCCTGACTTCAC -3'
Posted On2017-01-03