Incidental Mutation 'R5727:Gnb1'
ID452551
Institutional Source Beutler Lab
Gene Symbol Gnb1
Ensembl Gene ENSMUSG00000029064
Gene Nameguanine nucleotide binding protein (G protein), beta 1
Synonyms
MMRRC Submission 043190-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5727 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155491361-155559269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155555102 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 263 (T263A)
Ref Sequence ENSEMBL: ENSMUSP00000135091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030940] [ENSMUST00000105616] [ENSMUST00000165335] [ENSMUST00000176637] [ENSMUST00000177094]
Predicted Effect probably benign
Transcript: ENSMUST00000030940
AA Change: T263A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030940
Gene: ENSMUSG00000029064
AA Change: T263A

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105616
AA Change: T263A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101241
Gene: ENSMUSG00000029064
AA Change: T263A

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165335
AA Change: T263A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130123
Gene: ENSMUSG00000029064
AA Change: T263A

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176308
Predicted Effect probably benign
Transcript: ENSMUST00000176637
AA Change: T263A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135091
Gene: ENSMUSG00000029064
AA Change: T263A

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
WD40 257 298 1.88e-4 SMART
WD40 301 340 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177094
AA Change: T263A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135492
Gene: ENSMUSG00000029064
AA Change: T263A

DomainStartEndE-ValueType
WD40 44 83 1.05e-7 SMART
WD40 86 125 1.06e-3 SMART
WD40 132 170 1.93e-6 SMART
WD40 173 212 1.23e-8 SMART
WD40 215 254 5.06e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Heterozygous null mice have an abnormal retina morphology with progressive degeneration. Mice homozygous for a mutation of this gene show prenatal or perinatal lethality with exencephaly and/or small brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C A 14: 29,990,881 L494M probably benign Het
Ahnak G T 19: 9,016,747 A5132S probably damaging Het
Cadps G A 14: 12,486,525 Q882* probably null Het
Cdhr2 G A 13: 54,724,308 V662M possibly damaging Het
Cdyl2 T A 8: 116,583,168 I350F probably damaging Het
Cfap44 T G 16: 44,435,442 F966V probably damaging Het
Cpxm1 G A 2: 130,390,963 R704* probably null Het
Dnah11 A T 12: 118,127,106 F1034L probably damaging Het
Dpep2 A G 8: 105,986,443 V440A probably benign Het
Ehmt2 A T 17: 34,906,032 M11L possibly damaging Het
Eml2 C T 7: 19,190,760 H185Y probably damaging Het
Gm10845 T A 14: 79,863,330 noncoding transcript Het
Gm8122 T G 14: 43,234,020 N97T unknown Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ier5l A G 2: 30,473,159 C285R possibly damaging Het
Kif21b A G 1: 136,170,009 N1336D probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lama1 A G 17: 67,815,224 H2722R possibly damaging Het
Mdm2 A G 10: 117,702,307 M13T possibly damaging Het
Micall1 T A 15: 79,130,478 Y685N possibly damaging Het
Mthfd1l T G 10: 4,103,302 S884A possibly damaging Het
Nkiras2 A G 11: 100,625,027 Y60C probably damaging Het
Oc90 T G 15: 65,881,539 R342S possibly damaging Het
Olfr1181 T A 2: 88,423,447 I193F probably benign Het
Olfr12 A G 1: 92,620,178 N91D probably benign Het
Olfr1277 T A 2: 111,269,852 R172* probably null Het
Olfr350 T C 2: 36,850,532 L162P possibly damaging Het
Olfr748 C A 14: 50,710,360 T10K possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 G T 16: 35,964,097 E507* probably null Het
Pex13 A G 11: 23,655,705 I175T probably benign Het
Phf12 A G 11: 78,023,544 E604G probably damaging Het
Ppfia4 A T 1: 134,324,077 probably null Het
Rragc T C 4: 123,920,035 Y141H possibly damaging Het
Slc35g3 A G 11: 69,760,454 V257A probably benign Het
Snx5 T C 2: 144,260,754 T80A probably benign Het
Sorcs2 G A 5: 36,031,286 A826V possibly damaging Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Tmem161b T A 13: 84,286,790 S302R possibly damaging Het
Ube2o A T 11: 116,539,670 F1081I probably damaging Het
Vmn2r2 T C 3: 64,117,187 I658V probably benign Het
Vwa3b T G 1: 37,135,519 L672V probably benign Het
Wscd2 T C 5: 113,577,350 F417S possibly damaging Het
Other mutations in Gnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Gnb1 APN 4 155543188 missense probably damaging 1.00
IGL02052:Gnb1 APN 4 155533691 splice site probably benign
IGL02164:Gnb1 APN 4 155557174 unclassified probably null
IGL02470:Gnb1 APN 4 155527513 splice site probably benign
IGL02928:Gnb1 APN 4 155553406 missense probably benign
IGL03293:Gnb1 APN 4 155540547 splice site probably benign
R0034:Gnb1 UTSW 4 155551689 missense probably benign 0.03
R0325:Gnb1 UTSW 4 155551683 missense probably benign 0.21
R1538:Gnb1 UTSW 4 155551714 missense probably benign 0.00
R3498:Gnb1 UTSW 4 155555026 missense possibly damaging 0.49
R4177:Gnb1 UTSW 4 155540656 intron probably benign
R4746:Gnb1 UTSW 4 155543074 missense probably damaging 1.00
R4833:Gnb1 UTSW 4 155543067 missense possibly damaging 0.57
R6958:Gnb1 UTSW 4 155543194 critical splice donor site probably null
R7022:Gnb1 UTSW 4 155553456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGCAAGTGTTGAATCAG -3'
(R):5'- CCTCTGCTGAGCTATGACATAAC -3'

Sequencing Primer
(F):5'- CAAGTGTTGAATCAGCTGGCC -3'
(R):5'- CTGCTGAGCTATGACATAACTAAGC -3'
Posted On2017-01-03