Incidental Mutation 'R5727:Micall1'
ID452577
Institutional Source Beutler Lab
Gene Symbol Micall1
Ensembl Gene ENSMUSG00000033039
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing -like 1
SynonymsD15N2e, Mus EST 820961, D15Mit260
MMRRC Submission 043190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R5727 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79108898-79136900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79130478 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 685 (Y685N)
Ref Sequence ENSEMBL: ENSMUSP00000042053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040320] [ENSMUST00000169604] [ENSMUST00000187550] [ENSMUST00000188562] [ENSMUST00000189761] [ENSMUST00000190509] [ENSMUST00000190730] [ENSMUST00000190959] [ENSMUST00000229031]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040320
AA Change: Y685N

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042053
Gene: ENSMUSG00000033039
AA Change: Y685N

DomainStartEndE-ValueType
CH 4 103 5.64e-19 SMART
low complexity region 113 135 N/A INTRINSIC
LIM 164 219 1.15e-5 SMART
low complexity region 241 250 N/A INTRINSIC
low complexity region 375 394 N/A INTRINSIC
low complexity region 414 467 N/A INTRINSIC
low complexity region 477 497 N/A INTRINSIC
low complexity region 515 530 N/A INTRINSIC
low complexity region 571 586 N/A INTRINSIC
DUF3585 685 825 5.07e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169604
SMART Domains Protein: ENSMUSP00000129244
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 4 213 3.2e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186559
Predicted Effect probably benign
Transcript: ENSMUST00000187550
SMART Domains Protein: ENSMUSP00000140978
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188562
Predicted Effect probably benign
Transcript: ENSMUST00000189761
SMART Domains Protein: ENSMUSP00000139736
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 39 4.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190509
SMART Domains Protein: ENSMUSP00000140611
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 33 195 4.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190730
SMART Domains Protein: ENSMUSP00000139884
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190959
SMART Domains Protein: ENSMUSP00000140347
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 216 1.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230779
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C A 14: 29,990,881 L494M probably benign Het
Ahnak G T 19: 9,016,747 A5132S probably damaging Het
Cadps G A 14: 12,486,525 Q882* probably null Het
Cdhr2 G A 13: 54,724,308 V662M possibly damaging Het
Cdyl2 T A 8: 116,583,168 I350F probably damaging Het
Cfap44 T G 16: 44,435,442 F966V probably damaging Het
Cpxm1 G A 2: 130,390,963 R704* probably null Het
Dnah11 A T 12: 118,127,106 F1034L probably damaging Het
Dpep2 A G 8: 105,986,443 V440A probably benign Het
Ehmt2 A T 17: 34,906,032 M11L possibly damaging Het
Eml2 C T 7: 19,190,760 H185Y probably damaging Het
Gm10845 T A 14: 79,863,330 noncoding transcript Het
Gm8122 T G 14: 43,234,020 N97T unknown Het
Gnb1 A G 4: 155,555,102 T263A probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ier5l A G 2: 30,473,159 C285R possibly damaging Het
Kif21b A G 1: 136,170,009 N1336D probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lama1 A G 17: 67,815,224 H2722R possibly damaging Het
Mdm2 A G 10: 117,702,307 M13T possibly damaging Het
Mthfd1l T G 10: 4,103,302 S884A possibly damaging Het
Nkiras2 A G 11: 100,625,027 Y60C probably damaging Het
Oc90 T G 15: 65,881,539 R342S possibly damaging Het
Olfr1181 T A 2: 88,423,447 I193F probably benign Het
Olfr12 A G 1: 92,620,178 N91D probably benign Het
Olfr1277 T A 2: 111,269,852 R172* probably null Het
Olfr350 T C 2: 36,850,532 L162P possibly damaging Het
Olfr748 C A 14: 50,710,360 T10K possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 G T 16: 35,964,097 E507* probably null Het
Pex13 A G 11: 23,655,705 I175T probably benign Het
Phf12 A G 11: 78,023,544 E604G probably damaging Het
Ppfia4 A T 1: 134,324,077 probably null Het
Rragc T C 4: 123,920,035 Y141H possibly damaging Het
Slc35g3 A G 11: 69,760,454 V257A probably benign Het
Snx5 T C 2: 144,260,754 T80A probably benign Het
Sorcs2 G A 5: 36,031,286 A826V possibly damaging Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Tmem161b T A 13: 84,286,790 S302R possibly damaging Het
Ube2o A T 11: 116,539,670 F1081I probably damaging Het
Vmn2r2 T C 3: 64,117,187 I658V probably benign Het
Vwa3b T G 1: 37,135,519 L672V probably benign Het
Wscd2 T C 5: 113,577,350 F417S possibly damaging Het
Other mutations in Micall1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Micall1 APN 15 79115021 splice site probably benign
IGL00496:Micall1 APN 15 79115021 splice site probably benign
IGL00508:Micall1 APN 15 79130568 missense probably damaging 0.99
IGL01626:Micall1 APN 15 79130512 missense possibly damaging 0.46
IGL01868:Micall1 APN 15 79115060 missense probably benign 0.41
IGL03062:Micall1 APN 15 79114681 missense probably damaging 1.00
R0086:Micall1 UTSW 15 79125489 utr 3 prime probably benign
R0099:Micall1 UTSW 15 79131901 splice site probably benign
R0282:Micall1 UTSW 15 79131901 splice site probably benign
R0727:Micall1 UTSW 15 79120778 missense probably benign 0.00
R1859:Micall1 UTSW 15 79122945 intron probably benign
R2142:Micall1 UTSW 15 79130795 missense probably damaging 0.98
R2228:Micall1 UTSW 15 79129836 missense probably damaging 1.00
R3508:Micall1 UTSW 15 79122765 missense probably damaging 1.00
R4858:Micall1 UTSW 15 79122946 intron probably benign
R4888:Micall1 UTSW 15 79131848 nonsense probably null
R5059:Micall1 UTSW 15 79122834 intron probably benign
R5097:Micall1 UTSW 15 79129878 missense probably benign 0.17
R5451:Micall1 UTSW 15 79126904 intron probably null
R5710:Micall1 UTSW 15 79127090 missense probably damaging 1.00
R7135:Micall1 UTSW 15 79109424 missense unknown
R7186:Micall1 UTSW 15 79125375 missense unknown
R7297:Micall1 UTSW 15 79120897 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTCTGGAGGAGTCTGTCAGATC -3'
(R):5'- AGCTCTGCATTCCCAGGTTG -3'

Sequencing Primer
(F):5'- CAGATCTTGACATGAAGGGTTCC -3'
(R):5'- ATTCCCAGGTTGAGGGGC -3'
Posted On2017-01-03