Incidental Mutation 'R5728:Dgkz'
ID452586
Institutional Source Beutler Lab
Gene Symbol Dgkz
Ensembl Gene ENSMUSG00000040479
Gene Namediacylglycerol kinase zeta
SynonymsE130307B02Rik, mDGK[z]
MMRRC Submission 043345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5728 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91932824-91975864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91945787 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 44 (S44P)
Ref Sequence ENSEMBL: ENSMUSP00000106934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028667] [ENSMUST00000099709] [ENSMUST00000111303] [ENSMUST00000128152] [ENSMUST00000142090] [ENSMUST00000142231] [ENSMUST00000178895]
Predicted Effect probably benign
Transcript: ENSMUST00000028667
SMART Domains Protein: ENSMUSP00000028667
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
C1 96 153 2.67e-1 SMART
C1 173 231 8.18e-7 SMART
low complexity region 257 274 N/A INTRINSIC
DAGKc 296 420 4.61e-65 SMART
DAGKa 447 604 2.75e-95 SMART
low complexity region 762 780 N/A INTRINSIC
ANK 823 853 8.52e-4 SMART
ANK 858 887 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099709
SMART Domains Protein: ENSMUSP00000106937
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
C1 113 170 2.67e-1 SMART
C1 190 248 8.18e-7 SMART
low complexity region 274 291 N/A INTRINSIC
DAGKc 313 437 4.61e-65 SMART
DAGKa 464 621 2.75e-95 SMART
low complexity region 779 797 N/A INTRINSIC
ANK 840 870 8.52e-4 SMART
ANK 875 904 2.18e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111303
AA Change: S44P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106934
Gene: ENSMUSG00000040479
AA Change: S44P

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
C1 290 347 2.67e-1 SMART
C1 367 425 8.18e-7 SMART
low complexity region 451 468 N/A INTRINSIC
DAGKc 490 614 4.61e-65 SMART
DAGKa 641 798 2.75e-95 SMART
low complexity region 956 974 N/A INTRINSIC
ANK 1017 1047 8.52e-4 SMART
ANK 1052 1081 2.18e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126473
Predicted Effect probably benign
Transcript: ENSMUST00000128152
SMART Domains Protein: ENSMUSP00000118684
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:C1 62 114 9e-33 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142090
Predicted Effect probably benign
Transcript: ENSMUST00000142231
SMART Domains Protein: ENSMUSP00000114740
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000178895
AA Change: E28G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183498
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It may attenuate protein kinase C activity by regulating diacylglycerol levels in intracellular signaling cascade and signal transduction. Alternative splicing occurs at this locus and multiple transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2010]
PHENOTYPE: The T cell response is enhanced in homozygous mutant mice, which showed a robust response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik T A 2: 104,122,868 M13K possibly damaging Het
Abca13 T A 11: 9,570,576 V4493D probably damaging Het
Ank1 A G 8: 23,122,767 probably null Het
B4galnt4 A G 7: 141,070,575 D785G probably benign Het
Chtop C T 3: 90,500,092 G187D probably damaging Het
Cnih1 A G 14: 46,780,191 F78S probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcun1d4 T C 5: 73,520,148 F57L possibly damaging Het
Dhps A G 8: 85,073,335 D138G probably damaging Het
Elp2 A G 18: 24,617,452 E282G probably damaging Het
Exoc6b T C 6: 84,860,191 Y342C probably damaging Het
Fasn A C 11: 120,813,513 S1386A probably benign Het
Foxj3 A T 4: 119,573,762 N111Y probably damaging Het
Gm5431 T C 11: 48,888,613 E772G probably damaging Het
Gpbar1 A G 1: 74,279,057 N153S probably damaging Het
Hspg2 T C 4: 137,542,766 I2345T possibly damaging Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Lce1f A G 3: 92,719,345 S2P unknown Het
Lrrk2 A G 15: 91,774,974 D1863G probably benign Het
Lurap1 T C 4: 116,144,388 E36G possibly damaging Het
Lysmd3 A G 13: 81,669,261 E119G probably damaging Het
Map9 G A 3: 82,363,335 V69I probably benign Het
Mfsd4b2 A C 10: 39,923,795 F37C possibly damaging Het
Moxd1 A T 10: 24,223,683 H27L possibly damaging Het
Myo15 A T 11: 60,488,896 K1476N probably damaging Het
Mzf1 A G 7: 13,044,058 I552T probably benign Het
Nfatc2 A G 2: 168,480,249 V910A probably benign Het
Olfr666 C T 7: 104,893,229 R133Q possibly damaging Het
Prss2 T C 6: 41,523,917 V88A probably benign Het
Rhbdf1 A G 11: 32,209,901 probably null Het
Slc10a4 A T 5: 73,012,334 Q434L probably damaging Het
Slc4a3 A G 1: 75,549,840 T2A probably benign Het
Sqor A G 2: 122,809,400 *194W probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tagap1 A G 17: 6,957,021 V92A probably benign Het
Tiam2 A G 17: 3,414,956 Y320C probably damaging Het
Toporsl T C 4: 52,611,469 I454T probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ubap1l T C 9: 65,369,288 V24A probably benign Het
Unc13c A T 9: 73,558,956 S1810T probably benign Het
Vmn1r56 A T 7: 5,196,123 I165K probably benign Het
Wnt8b A G 19: 44,511,318 T169A possibly damaging Het
Wrap73 T C 4: 154,154,642 probably null Het
Wwc2 A G 8: 47,864,061 I703T unknown Het
Zfp354a T A 11: 51,070,605 C546S probably damaging Het
Other mutations in Dgkz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Dgkz APN 2 91935865 missense probably benign 0.00
IGL01995:Dgkz APN 2 91934050 splice site probably benign
IGL02247:Dgkz APN 2 91937460 missense probably benign 0.00
IGL02573:Dgkz APN 2 91934197 missense probably damaging 0.98
IGL02627:Dgkz APN 2 91938710 splice site probably benign
IGL02903:Dgkz APN 2 91939962 missense possibly damaging 0.45
IGL03106:Dgkz APN 2 91940859 missense probably damaging 0.99
R0103:Dgkz UTSW 2 91934205 missense probably benign
R0312:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R0761:Dgkz UTSW 2 91945351 missense probably benign 0.00
R0839:Dgkz UTSW 2 91935111 missense probably benign 0.00
R1162:Dgkz UTSW 2 91944444 missense probably damaging 1.00
R1223:Dgkz UTSW 2 91939315 splice site probably benign
R1539:Dgkz UTSW 2 91938060 missense probably damaging 1.00
R1934:Dgkz UTSW 2 91937104 missense possibly damaging 0.92
R1936:Dgkz UTSW 2 91937978 missense possibly damaging 0.94
R3438:Dgkz UTSW 2 91934050 splice site probably benign
R3804:Dgkz UTSW 2 91939630 missense probably benign 0.06
R4675:Dgkz UTSW 2 91938346 nonsense probably null
R4731:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4732:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4733:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4901:Dgkz UTSW 2 91936731 missense probably benign
R4972:Dgkz UTSW 2 91945702 missense probably benign 0.00
R5027:Dgkz UTSW 2 91945543 missense probably benign 0.02
R5128:Dgkz UTSW 2 91942683 missense probably damaging 1.00
R5408:Dgkz UTSW 2 91935823 missense possibly damaging 0.91
R5494:Dgkz UTSW 2 91941049 splice site probably null
R5813:Dgkz UTSW 2 91939388 missense possibly damaging 0.50
R6025:Dgkz UTSW 2 91945910 missense possibly damaging 0.75
R6043:Dgkz UTSW 2 91935889 missense probably benign 0.03
R6328:Dgkz UTSW 2 91942635 missense probably benign 0.04
R6335:Dgkz UTSW 2 91944379 missense probably benign 0.16
X0002:Dgkz UTSW 2 91936562 missense probably damaging 0.97
X0021:Dgkz UTSW 2 91937119 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCAACTGTGACAGGCTGTAG -3'
(R):5'- TTTCACAGAGGACAGAGGGTC -3'

Sequencing Primer
(F):5'- CAACTGTGACAGGCTGTAGGGTAG -3'
(R):5'- TGCTTCAGCTTGGCCCAG -3'
Posted On2017-01-03