Incidental Mutation 'R5728:Slc10a4'
ID452599
Institutional Source Beutler Lab
Gene Symbol Slc10a4
Ensembl Gene ENSMUSG00000029219
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 4
Synonyms
MMRRC Submission 043345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5728 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73006883-73012955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73012334 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 434 (Q434L)
Ref Sequence ENSEMBL: ENSMUSP00000031127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031127] [ENSMUST00000201304]
Predicted Effect probably damaging
Transcript: ENSMUST00000031127
AA Change: Q434L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031127
Gene: ENSMUSG00000029219
AA Change: Q434L

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 42 55 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
Pfam:SBF 111 290 1e-37 PFAM
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200747
Predicted Effect possibly damaging
Transcript: ENSMUST00000201304
AA Change: Q235L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144062
Gene: ENSMUSG00000029219
AA Change: Q235L

DomainStartEndE-ValueType
Pfam:SBF 1 91 1.7e-8 PFAM
transmembrane domain 101 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit seizures and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik T A 2: 104,122,868 M13K possibly damaging Het
Abca13 T A 11: 9,570,576 V4493D probably damaging Het
Ank1 A G 8: 23,122,767 probably null Het
B4galnt4 A G 7: 141,070,575 D785G probably benign Het
Chtop C T 3: 90,500,092 G187D probably damaging Het
Cnih1 A G 14: 46,780,191 F78S probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcun1d4 T C 5: 73,520,148 F57L possibly damaging Het
Dgkz A G 2: 91,945,787 S44P possibly damaging Het
Dhps A G 8: 85,073,335 D138G probably damaging Het
Elp2 A G 18: 24,617,452 E282G probably damaging Het
Exoc6b T C 6: 84,860,191 Y342C probably damaging Het
Fasn A C 11: 120,813,513 S1386A probably benign Het
Foxj3 A T 4: 119,573,762 N111Y probably damaging Het
Gm5431 T C 11: 48,888,613 E772G probably damaging Het
Gpbar1 A G 1: 74,279,057 N153S probably damaging Het
Hspg2 T C 4: 137,542,766 I2345T possibly damaging Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Lce1f A G 3: 92,719,345 S2P unknown Het
Lrrk2 A G 15: 91,774,974 D1863G probably benign Het
Lurap1 T C 4: 116,144,388 E36G possibly damaging Het
Lysmd3 A G 13: 81,669,261 E119G probably damaging Het
Map9 G A 3: 82,363,335 V69I probably benign Het
Mfsd4b2 A C 10: 39,923,795 F37C possibly damaging Het
Moxd1 A T 10: 24,223,683 H27L possibly damaging Het
Myo15 A T 11: 60,488,896 K1476N probably damaging Het
Mzf1 A G 7: 13,044,058 I552T probably benign Het
Nfatc2 A G 2: 168,480,249 V910A probably benign Het
Olfr666 C T 7: 104,893,229 R133Q possibly damaging Het
Prss2 T C 6: 41,523,917 V88A probably benign Het
Rhbdf1 A G 11: 32,209,901 probably null Het
Slc4a3 A G 1: 75,549,840 T2A probably benign Het
Sqor A G 2: 122,809,400 *194W probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tagap1 A G 17: 6,957,021 V92A probably benign Het
Tiam2 A G 17: 3,414,956 Y320C probably damaging Het
Toporsl T C 4: 52,611,469 I454T probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ubap1l T C 9: 65,369,288 V24A probably benign Het
Unc13c A T 9: 73,558,956 S1810T probably benign Het
Vmn1r56 A T 7: 5,196,123 I165K probably benign Het
Wnt8b A G 19: 44,511,318 T169A possibly damaging Het
Wrap73 T C 4: 154,154,642 probably null Het
Wwc2 A G 8: 47,864,061 I703T unknown Het
Zfp354a T A 11: 51,070,605 C546S probably damaging Het
Other mutations in Slc10a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Slc10a4 APN 5 73011920 missense probably damaging 0.98
IGL01121:Slc10a4 APN 5 73007586 missense probably damaging 0.99
IGL03324:Slc10a4 APN 5 73011943 missense probably damaging 1.00
R1727:Slc10a4 UTSW 5 73016148 unclassified probably benign
R1889:Slc10a4 UTSW 5 73012147 missense possibly damaging 0.91
R2071:Slc10a4 UTSW 5 73007497 missense probably damaging 1.00
R2091:Slc10a4 UTSW 5 73017139 unclassified probably benign
R2137:Slc10a4 UTSW 5 73007580 missense probably damaging 1.00
R2516:Slc10a4 UTSW 5 73008505 missense possibly damaging 0.62
R4723:Slc10a4 UTSW 5 73012055 missense probably damaging 1.00
R5838:Slc10a4 UTSW 5 73012030 missense probably benign 0.00
R6175:Slc10a4 UTSW 5 73012250 missense possibly damaging 0.60
X0066:Slc10a4 UTSW 5 73008505 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CGCCTCGCTTTATAGGTAGC -3'
(R):5'- AGCAATACTGGGACTCTGTTG -3'

Sequencing Primer
(F):5'- AGGTAGCATGTACATGTTCCC -3'
(R):5'- TCTGTTGAGTTAGAAAAACACATGGG -3'
Posted On2017-01-03