Incidental Mutation 'R5728:Fasn'
ID452622
Institutional Source Beutler Lab
Gene Symbol Fasn
Ensembl Gene ENSMUSG00000025153
Gene Namefatty acid synthase
SynonymsFAS, A630082H08Rik
MMRRC Submission 043345-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5728 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120805846-120824547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 120813513 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1386 (S1386A)
Ref Sequence ENSEMBL: ENSMUSP00000145585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055655] [ENSMUST00000206589]
Predicted Effect probably benign
Transcript: ENSMUST00000055655
AA Change: S1388A

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052872
Gene: ENSMUSG00000025153
AA Change: S1388A

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 1 239 6.8e-73 PFAM
Pfam:Ketoacyl-synt_C 243 360 3.7e-38 PFAM
Pfam:KAsynt_C_assoc 362 474 8.2e-46 PFAM
Pfam:Acyl_transf_1 493 810 9.5e-115 PFAM
Pfam:PS-DH 853 1169 9.9e-24 PFAM
low complexity region 1175 1204 N/A INTRINSIC
Pfam:Methyltransf_12 1238 1337 2e-9 PFAM
PKS_ER 1532 1847 1.44e-147 SMART
PKS_KR 1878 2059 2.33e-42 SMART
Pfam:PP-binding 2119 2185 1.1e-10 PFAM
Pfam:Thioesterase 2235 2494 1.6e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155276
Predicted Effect probably benign
Transcript: ENSMUST00000206589
AA Change: S1386A

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206637
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutation of this locus has implicated its product in embryogenesis as all homozygotes and most heterozygotes die prior to birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik T A 2: 104,122,868 M13K possibly damaging Het
Abca13 T A 11: 9,570,576 V4493D probably damaging Het
Ank1 A G 8: 23,122,767 probably null Het
B4galnt4 A G 7: 141,070,575 D785G probably benign Het
Chtop C T 3: 90,500,092 G187D probably damaging Het
Cnih1 A G 14: 46,780,191 F78S probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcun1d4 T C 5: 73,520,148 F57L possibly damaging Het
Dgkz A G 2: 91,945,787 S44P possibly damaging Het
Dhps A G 8: 85,073,335 D138G probably damaging Het
Elp2 A G 18: 24,617,452 E282G probably damaging Het
Exoc6b T C 6: 84,860,191 Y342C probably damaging Het
Foxj3 A T 4: 119,573,762 N111Y probably damaging Het
Gm5431 T C 11: 48,888,613 E772G probably damaging Het
Gpbar1 A G 1: 74,279,057 N153S probably damaging Het
Hspg2 T C 4: 137,542,766 I2345T possibly damaging Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Lce1f A G 3: 92,719,345 S2P unknown Het
Lrrk2 A G 15: 91,774,974 D1863G probably benign Het
Lurap1 T C 4: 116,144,388 E36G possibly damaging Het
Lysmd3 A G 13: 81,669,261 E119G probably damaging Het
Map9 G A 3: 82,363,335 V69I probably benign Het
Mfsd4b2 A C 10: 39,923,795 F37C possibly damaging Het
Moxd1 A T 10: 24,223,683 H27L possibly damaging Het
Myo15 A T 11: 60,488,896 K1476N probably damaging Het
Mzf1 A G 7: 13,044,058 I552T probably benign Het
Nfatc2 A G 2: 168,480,249 V910A probably benign Het
Olfr666 C T 7: 104,893,229 R133Q possibly damaging Het
Prss2 T C 6: 41,523,917 V88A probably benign Het
Rhbdf1 A G 11: 32,209,901 probably null Het
Slc10a4 A T 5: 73,012,334 Q434L probably damaging Het
Slc4a3 A G 1: 75,549,840 T2A probably benign Het
Sqor A G 2: 122,809,400 *194W probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tagap1 A G 17: 6,957,021 V92A probably benign Het
Tiam2 A G 17: 3,414,956 Y320C probably damaging Het
Toporsl T C 4: 52,611,469 I454T probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ubap1l T C 9: 65,369,288 V24A probably benign Het
Unc13c A T 9: 73,558,956 S1810T probably benign Het
Vmn1r56 A T 7: 5,196,123 I165K probably benign Het
Wnt8b A G 19: 44,511,318 T169A possibly damaging Het
Wrap73 T C 4: 154,154,642 probably null Het
Wwc2 A G 8: 47,864,061 I703T unknown Het
Zfp354a T A 11: 51,070,605 C546S probably damaging Het
Other mutations in Fasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fasn APN 11 120820539 missense probably damaging 1.00
IGL01014:Fasn APN 11 120817229 missense probably damaging 0.99
IGL01131:Fasn APN 11 120814619 missense probably benign 0.01
IGL01603:Fasn APN 11 120816065 missense probably damaging 0.99
IGL01606:Fasn APN 11 120809023 critical splice donor site probably null
IGL01897:Fasn APN 11 120807939 missense probably damaging 1.00
IGL01899:Fasn APN 11 120820149 splice site probably benign
IGL01987:Fasn APN 11 120818073 missense probably damaging 1.00
IGL02103:Fasn APN 11 120811936 missense probably damaging 1.00
IGL02212:Fasn APN 11 120807903 missense probably damaging 1.00
IGL02294:Fasn APN 11 120810276 missense probably damaging 0.98
IGL02336:Fasn APN 11 120813736 missense possibly damaging 0.48
IGL02417:Fasn APN 11 120820340 missense probably damaging 1.00
IGL02452:Fasn APN 11 120808180 missense probably benign 0.00
IGL02559:Fasn APN 11 120809066 missense possibly damaging 0.51
IGL02724:Fasn APN 11 120809833 missense probably benign 0.41
IGL02862:Fasn APN 11 120818979 missense possibly damaging 0.89
IGL02947:Fasn APN 11 120815676 missense probably damaging 0.99
IGL03025:Fasn APN 11 120818148 missense probably benign 0.01
IGL03131:Fasn APN 11 120810724 missense possibly damaging 0.93
IGL03157:Fasn APN 11 120807909 missense probably benign 0.12
IGL03182:Fasn APN 11 120812726 missense probably damaging 1.00
IGL03370:Fasn APN 11 120812795 missense possibly damaging 0.95
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0243:Fasn UTSW 11 120815315 missense probably benign 0.00
R0304:Fasn UTSW 11 120819936 missense possibly damaging 0.85
R0389:Fasn UTSW 11 120816182 missense probably damaging 1.00
R0449:Fasn UTSW 11 120811068 missense probably benign
R0626:Fasn UTSW 11 120811925 missense probably damaging 0.99
R1037:Fasn UTSW 11 120809451 missense probably benign
R1061:Fasn UTSW 11 120822182 unclassified probably null
R1109:Fasn UTSW 11 120812324 missense possibly damaging 0.77
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1498:Fasn UTSW 11 120815419 missense probably damaging 0.98
R1552:Fasn UTSW 11 120818558 missense probably damaging 1.00
R1568:Fasn UTSW 11 120813249 missense possibly damaging 0.78
R1624:Fasn UTSW 11 120813111 missense probably damaging 1.00
R1774:Fasn UTSW 11 120817171 missense probably damaging 1.00
R1826:Fasn UTSW 11 120808499 splice site probably benign
R1846:Fasn UTSW 11 120813307 missense probably benign 0.00
R2298:Fasn UTSW 11 120813816 missense possibly damaging 0.78
R2513:Fasn UTSW 11 120814748 missense probably damaging 1.00
R3001:Fasn UTSW 11 120809845 missense probably benign
R3002:Fasn UTSW 11 120809845 missense probably benign
R3154:Fasn UTSW 11 120807939 missense probably damaging 1.00
R3434:Fasn UTSW 11 120822773 missense probably damaging 0.99
R4794:Fasn UTSW 11 120811295 missense probably benign 0.36
R4840:Fasn UTSW 11 120813059 missense possibly damaging 0.83
R4863:Fasn UTSW 11 120808828 missense probably damaging 1.00
R4876:Fasn UTSW 11 120812312 missense probably damaging 1.00
R4914:Fasn UTSW 11 120816646 missense probably benign 0.39
R4915:Fasn UTSW 11 120816646 missense probably benign 0.39
R4916:Fasn UTSW 11 120816646 missense probably benign 0.39
R4918:Fasn UTSW 11 120816646 missense probably benign 0.39
R4936:Fasn UTSW 11 120816085 missense probably damaging 1.00
R5025:Fasn UTSW 11 120811908 missense probably benign 0.00
R5092:Fasn UTSW 11 120815036 missense probably benign 0.00
R5120:Fasn UTSW 11 120811391 missense probably benign 0.22
R5175:Fasn UTSW 11 120816369 missense probably benign 0.14
R5183:Fasn UTSW 11 120808882 missense probably benign 0.44
R5506:Fasn UTSW 11 120809510 missense probably benign 0.26
R5557:Fasn UTSW 11 120812426 missense probably benign 0.10
R5614:Fasn UTSW 11 120813328 missense probably benign
R5838:Fasn UTSW 11 120816124 missense probably damaging 0.98
R5959:Fasn UTSW 11 120808564 missense probably damaging 0.99
R6029:Fasn UTSW 11 120820909 missense probably damaging 1.00
R6134:Fasn UTSW 11 120822186 missense probably benign 0.05
R6335:Fasn UTSW 11 120815359 missense probably damaging 0.96
R6452:Fasn UTSW 11 120815411 missense probably damaging 1.00
R6627:Fasn UTSW 11 120818927 missense probably benign 0.10
R6742:Fasn UTSW 11 120810453 missense probably damaging 0.96
R6767:Fasn UTSW 11 120817487 missense possibly damaging 0.62
R6927:Fasn UTSW 11 120808289 missense probably benign 0.03
R6976:Fasn UTSW 11 120819867 missense probably damaging 1.00
R7092:Fasn UTSW 11 120820120 missense possibly damaging 0.56
X0067:Fasn UTSW 11 120816303 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATAAAGGAGGGTCAGCCTC -3'
(R):5'- ACAGTGCTCAAAGGACATGCC -3'

Sequencing Primer
(F):5'- CTCAGGGCTGTTCATATGCCAG -3'
(R):5'- TCAAAGGACATGCCCTTGG -3'
Posted On2017-01-03