Incidental Mutation 'R5729:Cacna2d1'
ID452647
Institutional Source Beutler Lab
Gene Symbol Cacna2d1
Ensembl Gene ENSMUSG00000040118
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 1
SynonymsCa(v)alpha2delta1, Cacna2, Cchl2a
MMRRC Submission 043346-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R5729 (G1)
Quality Score222
Status Not validated
Chromosome5
Chromosomal Location15934691-16374511 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 15935039 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 9 (L9*)
Ref Sequence ENSEMBL: ENSMUSP00000142881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039370] [ENSMUST00000078272] [ENSMUST00000101581] [ENSMUST00000115281] [ENSMUST00000167946] [ENSMUST00000180204] [ENSMUST00000196750] [ENSMUST00000199704]
Predicted Effect probably null
Transcript: ENSMUST00000039370
AA Change: L9*
SMART Domains Protein: ENSMUSP00000049457
Gene: ENSMUSG00000040118
AA Change: L9*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.3e-42 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 536 1e-31 PFAM
Pfam:VGCC_alpha2 562 655 1e-46 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078272
AA Change: L9*
SMART Domains Protein: ENSMUSP00000077391
Gene: ENSMUSG00000040118
AA Change: L9*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 634 3.3e-53 PFAM
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101581
AA Change: L9*
SMART Domains Protein: ENSMUSP00000099117
Gene: ENSMUSG00000040118
AA Change: L9*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 636 1.2e-59 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115281
AA Change: L9*
SMART Domains Protein: ENSMUSP00000110936
Gene: ENSMUSG00000040118
AA Change: L9*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167946
AA Change: L9*
SMART Domains Protein: ENSMUSP00000131507
Gene: ENSMUSG00000040118
AA Change: L9*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 3.8e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 2.6e-30 PFAM
Pfam:VGCC_alpha2 543 636 5.5e-56 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000180204
AA Change: L9*
SMART Domains Protein: ENSMUSP00000136260
Gene: ENSMUSG00000040118
AA Change: L9*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180447
Predicted Effect probably null
Transcript: ENSMUST00000196750
AA Change: L9*
SMART Domains Protein: ENSMUSP00000143082
Gene: ENSMUSG00000040118
AA Change: L9*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199704
AA Change: L9*
SMART Domains Protein: ENSMUSP00000142881
Gene: ENSMUSG00000040118
AA Change: L9*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 6.3e-30 PFAM
Pfam:VGCC_alpha2 538 629 3.3e-53 PFAM
low complexity region 651 662 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: This gene encodes a regulatory component of the voltage-dependent calcium channel complex. The product of this gene is a proprotein that is proteolytically processed into alpha-2 and delta subunits, which are linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice with a point mutation allele exhibit abnormal CNS synaptic transmission and decreased response to pregabalin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss A T 1: 177,796,258 V46E possibly damaging Het
Aldoart2 T C 12: 55,565,905 V205A probably benign Het
Atp1a2 A G 1: 172,293,371 S45P probably damaging Het
Atp4a A G 7: 30,712,426 K29E possibly damaging Het
AU040320 T A 4: 126,830,415 D428E probably damaging Het
Bend7 T C 2: 4,763,274 L347P probably damaging Het
Ccdc103 A T 11: 102,883,078 I50F probably damaging Het
Cdc5l T C 17: 45,426,569 I88V probably benign Het
Cracr2a T C 6: 127,607,236 V86A possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dgkd C T 1: 87,936,332 Q90* probably null Het
Dnajc21 A T 15: 10,449,596 D446E probably benign Het
Fam13a T G 6: 58,939,307 R648S probably damaging Het
Gabrg2 A G 11: 41,967,623 V226A probably damaging Het
Gm5499 A T 17: 87,078,516 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Irf2bp1 G T 7: 19,005,247 E271* probably null Het
Krt86 T G 15: 101,476,548 V274G probably benign Het
Lats2 A T 14: 57,722,735 C151S probably benign Het
Mapk3 A T 7: 126,764,807 T254S probably benign Het
Mat2b A T 11: 40,682,546 M202K probably damaging Het
Mos A G 4: 3,870,971 Y282H probably benign Het
Myo3b A G 2: 70,105,739 K108R probably damaging Het
Naa16 A G 14: 79,355,780 Y417H probably damaging Het
Oat A T 7: 132,558,255 I412N probably damaging Het
Olfr1423 A T 19: 12,035,908 I278N probably damaging Het
Pcdh1 A T 18: 38,202,946 V73D probably damaging Het
Pigv A T 4: 133,664,823 Y345* probably null Het
Pitpnc1 G T 11: 107,337,438 F34L probably benign Het
Plxnd1 A G 6: 115,965,877 L1282P probably damaging Het
Ppp1r3a T C 6: 14,719,763 D384G probably benign Het
Ppp2ca G A 11: 52,118,029 E119K probably damaging Het
Psg29 A T 7: 17,210,534 N323I probably damaging Het
Rasa4 T C 5: 136,093,162 V108A probably benign Het
Rbm14 A G 19: 4,802,549 probably benign Het
Rfc1 A T 5: 65,277,452 V657E probably damaging Het
Rhcg A T 7: 79,600,623 N237K probably damaging Het
Rpgrip1 A G 14: 52,160,160 Q1302R probably benign Het
Rragc A G 4: 123,924,852 M287V possibly damaging Het
Scn7a A G 2: 66,741,957 probably null Het
Sema6a C T 18: 47,281,343 C506Y probably damaging Het
Senp1 G T 15: 98,066,531 H267Q possibly damaging Het
Skor2 A G 18: 76,858,883 E100G unknown Het
Slc38a11 A T 2: 65,317,021 C371S probably benign Het
Snai3 G A 8: 122,454,890 A276V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spag6 C T 2: 18,715,714 T99I probably benign Het
Spop A G 11: 95,485,849 I243V possibly damaging Het
Sra1 A T 18: 36,667,443 probably benign Het
Stag3 T A 5: 138,290,223 S140T possibly damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tbc1d2b G C 9: 90,207,872 A868G probably benign Het
Tead2 A G 7: 45,220,742 probably benign Het
Tmem53 C A 4: 117,268,472 H261N probably damaging Het
Ube4a A T 9: 44,933,329 S932T probably damaging Het
Usp9y A T Y: 1,381,339 D827E probably damaging Het
Vmn2r53 T C 7: 12,600,806 E309G probably damaging Het
Wrn T C 8: 33,268,778 S1026G probably benign Het
Zfp646 G A 7: 127,885,454 A1760T probably damaging Het
Other mutations in Cacna2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cacna2d1 APN 5 16212944 missense probably damaging 1.00
IGL00470:Cacna2d1 APN 5 16246656 splice site probably benign
IGL00495:Cacna2d1 APN 5 16370609 missense probably benign 0.05
IGL00538:Cacna2d1 APN 5 16246785 nonsense probably null
IGL00990:Cacna2d1 APN 5 15935069 missense probably benign 0.23
IGL01079:Cacna2d1 APN 5 16370648 missense probably benign 0.03
IGL01344:Cacna2d1 APN 5 16370631 missense probably benign 0.26
IGL01597:Cacna2d1 APN 5 16326392 splice site probably benign
IGL01645:Cacna2d1 APN 5 16012391 splice site probably null
IGL01959:Cacna2d1 APN 5 16212897 missense probably benign 0.00
IGL02397:Cacna2d1 APN 5 16320164 splice site probably benign
IGL03152:Cacna2d1 APN 5 16322568 missense probably benign 0.00
IGL03216:Cacna2d1 APN 5 16353842 missense probably damaging 0.98
IGL03374:Cacna2d1 APN 5 16356823 missense probably damaging 0.99
PIT4283001:Cacna2d1 UTSW 5 16302294 missense probably benign 0.31
PIT4585001:Cacna2d1 UTSW 5 16326344 missense probably damaging 1.00
R0158:Cacna2d1 UTSW 5 16361817 splice site probably benign
R0457:Cacna2d1 UTSW 5 16267416 missense probably damaging 1.00
R0477:Cacna2d1 UTSW 5 16194798 critical splice donor site probably null
R0483:Cacna2d1 UTSW 5 16359027 missense probably damaging 0.98
R0532:Cacna2d1 UTSW 5 16362273 missense probably benign 0.13
R0552:Cacna2d1 UTSW 5 16328043 missense probably damaging 1.00
R0924:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R0930:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R1144:Cacna2d1 UTSW 5 16322597 critical splice donor site probably null
R1164:Cacna2d1 UTSW 5 16361876 critical splice donor site probably null
R1398:Cacna2d1 UTSW 5 16357766 missense possibly damaging 0.47
R1440:Cacna2d1 UTSW 5 16355495 missense probably damaging 1.00
R1543:Cacna2d1 UTSW 5 16266718 missense possibly damaging 0.62
R1573:Cacna2d1 UTSW 5 16370627 missense probably damaging 1.00
R1633:Cacna2d1 UTSW 5 16320116 missense probably damaging 1.00
R1673:Cacna2d1 UTSW 5 16299990 missense probably damaging 1.00
R1750:Cacna2d1 UTSW 5 16264288 missense probably benign 0.01
R1753:Cacna2d1 UTSW 5 16302354 missense possibly damaging 0.95
R1966:Cacna2d1 UTSW 5 16333785 nonsense probably null
R2163:Cacna2d1 UTSW 5 16362319 missense probably damaging 1.00
R2258:Cacna2d1 UTSW 5 16357289 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R4303:Cacna2d1 UTSW 5 16302248 intron probably null
R4804:Cacna2d1 UTSW 5 16359208 missense probably damaging 0.97
R5032:Cacna2d1 UTSW 5 16359070 missense probably damaging 1.00
R5080:Cacna2d1 UTSW 5 16362396 critical splice donor site probably null
R5466:Cacna2d1 UTSW 5 16246714 missense probably damaging 1.00
R5469:Cacna2d1 UTSW 5 16352678 missense probably damaging 0.99
R5564:Cacna2d1 UTSW 5 16312519 missense probably damaging 1.00
R5655:Cacna2d1 UTSW 5 16302335 missense probably damaging 1.00
R5688:Cacna2d1 UTSW 5 16358952 missense probably damaging 0.99
R6005:Cacna2d1 UTSW 5 16361821 missense probably damaging 1.00
R6343:Cacna2d1 UTSW 5 16322564 missense probably benign 0.09
R6485:Cacna2d1 UTSW 5 16354657 missense probably damaging 1.00
R6486:Cacna2d1 UTSW 5 16319450 unclassified probably null
R6625:Cacna2d1 UTSW 5 16362393 missense probably null 1.00
R6700:Cacna2d1 UTSW 5 16365460 missense probably damaging 1.00
R6706:Cacna2d1 UTSW 5 16326340 missense probably damaging 1.00
R6711:Cacna2d1 UTSW 5 16300041 missense probably damaging 1.00
R7025:Cacna2d1 UTSW 5 16352668 nonsense probably null
R7035:Cacna2d1 UTSW 5 16246672 missense probably damaging 1.00
R7086:Cacna2d1 UTSW 5 16349416 missense probably damaging 1.00
R7110:Cacna2d1 UTSW 5 16357784 missense probably damaging 0.99
R7268:Cacna2d1 UTSW 5 16370588 missense probably damaging 0.99
R7310:Cacna2d1 UTSW 5 16314916 missense probably damaging 1.00
Z1088:Cacna2d1 UTSW 5 16194763 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCCACAGTCGCCCTTGATG -3'
(R):5'- ACAGTCTTCAGCTTGCAGC -3'

Sequencing Primer
(F):5'- ACGCGCTAGAGAGTCCG -3'
(R):5'- TTGCAGCATCCTCGGAGAC -3'
Posted On2017-01-03