Incidental Mutation 'R5730:Brca2'
ID452710
Institutional Source Beutler Lab
Gene Symbol Brca2
Ensembl Gene ENSMUSG00000041147
Gene Namebreast cancer 2, early onset
SynonymsFancd1, RAB163
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location150522630-150570329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150569005 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 3162 (S3162T)
Ref Sequence ENSEMBL: ENSMUSP00000144150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016279] [ENSMUST00000044620] [ENSMUST00000202031] [ENSMUST00000202279] [ENSMUST00000202291] [ENSMUST00000202313]
Predicted Effect probably benign
Transcript: ENSMUST00000016279
SMART Domains Protein: ENSMUSP00000016279
Gene: ENSMUSG00000041132

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:AAA_33 42 176 6.1e-19 PFAM
Pfam:AAA_17 42 198 3.2e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000044620
AA Change: S3162T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: S3162T

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201843
Predicted Effect probably benign
Transcript: ENSMUST00000202031
SMART Domains Protein: ENSMUSP00000144164
Gene: ENSMUSG00000041132

DomainStartEndE-ValueType
SCOP:d1ly1a_ 8 71 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202279
SMART Domains Protein: ENSMUSP00000143792
Gene: ENSMUSG00000041132

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
SCOP:d1l4ua_ 42 58 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202291
Predicted Effect possibly damaging
Transcript: ENSMUST00000202313
AA Change: S3162T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: S3162T

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Brca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Brca2 APN 5 150539898 missense probably benign 0.18
IGL00392:Brca2 APN 5 150541240 missense probably benign 0.02
IGL00557:Brca2 APN 5 150560538 missense probably benign
IGL00798:Brca2 APN 5 150539463 missense probably benign 0.30
IGL00933:Brca2 APN 5 150542404 missense probably benign 0.04
IGL00964:Brca2 APN 5 150532310 missense probably damaging 1.00
IGL01152:Brca2 APN 5 150542390 missense probably damaging 0.99
IGL01577:Brca2 APN 5 150541620 nonsense probably null
IGL01585:Brca2 APN 5 150539516 missense possibly damaging 0.76
IGL01732:Brca2 APN 5 150542387 missense probably benign 0.13
IGL01809:Brca2 APN 5 150531061 splice site probably null
IGL01911:Brca2 APN 5 150567613 missense probably damaging 0.96
IGL02113:Brca2 APN 5 150540979 missense possibly damaging 0.95
IGL02313:Brca2 APN 5 150538661 missense probably damaging 1.00
IGL02342:Brca2 APN 5 150542824 missense possibly damaging 0.94
IGL02508:Brca2 APN 5 150543308 missense possibly damaging 0.85
IGL02532:Brca2 APN 5 150550862 missense probably damaging 1.00
IGL02646:Brca2 APN 5 150560790 missense possibly damaging 0.89
IGL02738:Brca2 APN 5 150567035 missense probably damaging 1.00
IGL02833:Brca2 APN 5 150541790 missense possibly damaging 0.83
IGL02871:Brca2 APN 5 150542552 missense probably benign 0.13
IGL02995:Brca2 APN 5 150529488 missense probably damaging 1.00
IGL03105:Brca2 APN 5 150560485 missense probably benign 0.02
R0219:Brca2 UTSW 5 150523175 splice site probably benign
R0416:Brca2 UTSW 5 150569392 missense possibly damaging 0.93
R0441:Brca2 UTSW 5 150541857 missense probably damaging 0.96
R0548:Brca2 UTSW 5 150544935 missense probably damaging 0.96
R0745:Brca2 UTSW 5 150544882 splice site probably benign
R0799:Brca2 UTSW 5 150560193 missense probably damaging 0.99
R1165:Brca2 UTSW 5 150542747 missense probably damaging 0.98
R1247:Brca2 UTSW 5 150541274 missense probably damaging 1.00
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1444:Brca2 UTSW 5 150542450 missense probably benign
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1584:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1599:Brca2 UTSW 5 150548713 nonsense probably null
R1600:Brca2 UTSW 5 150560830 splice site probably benign
R1822:Brca2 UTSW 5 150540198 missense probably benign 0.06
R1824:Brca2 UTSW 5 150536922 missense possibly damaging 0.94
R2037:Brca2 UTSW 5 150540669 missense probably benign
R2131:Brca2 UTSW 5 150557129 missense probably damaging 1.00
R2203:Brca2 UTSW 5 150539502 missense possibly damaging 0.58
R2208:Brca2 UTSW 5 150532344 missense probably damaging 0.96
R2293:Brca2 UTSW 5 150560534 missense possibly damaging 0.86
R2517:Brca2 UTSW 5 150539672 missense probably benign 0.04
R2566:Brca2 UTSW 5 150541762 missense probably benign 0.03
R3422:Brca2 UTSW 5 150543121 missense possibly damaging 0.91
R3917:Brca2 UTSW 5 150540827 missense probably damaging 0.96
R3946:Brca2 UTSW 5 150536704 missense probably damaging 0.96
R4176:Brca2 UTSW 5 150539633 nonsense probably null
R4255:Brca2 UTSW 5 150541169 missense possibly damaging 0.92
R4450:Brca2 UTSW 5 150536053 missense probably damaging 0.96
R4603:Brca2 UTSW 5 150536165 missense possibly damaging 0.86
R4681:Brca2 UTSW 5 150552398 splice site probably null
R4755:Brca2 UTSW 5 150559987 intron probably null
R4762:Brca2 UTSW 5 150531116 missense probably benign 0.00
R4824:Brca2 UTSW 5 150539735 missense probably damaging 1.00
R4887:Brca2 UTSW 5 150556937 missense probably damaging 1.00
R5020:Brca2 UTSW 5 150560436 missense probably damaging 1.00
R5159:Brca2 UTSW 5 150542108 missense possibly damaging 0.93
R5216:Brca2 UTSW 5 150542980 missense probably damaging 0.99
R5269:Brca2 UTSW 5 150539223 missense possibly damaging 0.75
R5274:Brca2 UTSW 5 150539689 missense probably benign 0.00
R5589:Brca2 UTSW 5 150557132 missense possibly damaging 0.67
R5619:Brca2 UTSW 5 150557114 missense probably damaging 0.96
R5641:Brca2 UTSW 5 150556899 missense probably damaging 1.00
R5686:Brca2 UTSW 5 150540904 missense probably benign 0.00
R5763:Brca2 UTSW 5 150548006 missense possibly damaging 0.85
R5877:Brca2 UTSW 5 150543221 missense possibly damaging 0.53
R5893:Brca2 UTSW 5 150569138 missense probably benign 0.02
R5900:Brca2 UTSW 5 150541132 missense probably benign 0.01
R5926:Brca2 UTSW 5 150534622 missense probably benign 0.07
R5966:Brca2 UTSW 5 150543251 missense probably damaging 0.99
R6025:Brca2 UTSW 5 150541575 frame shift probably null
R6062:Brca2 UTSW 5 150556889 missense probably damaging 0.96
R6141:Brca2 UTSW 5 150540637 missense possibly damaging 0.91
R6244:Brca2 UTSW 5 150566978 missense probably benign 0.08
R6508:Brca2 UTSW 5 150536593 missense possibly damaging 0.91
R6519:Brca2 UTSW 5 150540979 missense probably damaging 0.99
R6611:Brca2 UTSW 5 150536193 missense probably damaging 0.99
R6698:Brca2 UTSW 5 150532394 missense probably damaging 1.00
R6856:Brca2 UTSW 5 150540208 missense possibly damaging 0.68
R6912:Brca2 UTSW 5 150541742 missense probably damaging 0.99
R7002:Brca2 UTSW 5 150539918 missense probably benign
R7025:Brca2 UTSW 5 150540478 missense probably benign 0.39
R7151:Brca2 UTSW 5 150541436 missense probably benign 0.12
R7202:Brca2 UTSW 5 150532354 missense probably benign 0.03
R7365:Brca2 UTSW 5 150532337 missense probably damaging 0.99
Z1088:Brca2 UTSW 5 150542763 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCTTTAGCAATTGGAAAGGAAAG -3'
(R):5'- TATTTCGTGCCACAGCTCCG -3'

Sequencing Primer
(F):5'- TTTAGCAATTGGAAAGGAAAGGTGTC -3'
(R):5'- TGAAAAGCCTTCTGTGCAGC -3'
Posted On2017-01-03