Incidental Mutation 'R5120:Celsr2'
ID452821
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Namecadherin, EGF LAG seven-pass G-type receptor 2
Synonymsmfmi1, EGFL2, flamingo
MMRRC Submission 042708-MU
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5120 (G1)
Quality Score75
Status Validated
Chromosome3
Chromosomal Location108390851-108415552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 108393120 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 2875 (P2875A)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558] [ENSMUST00000090561] [ENSMUST00000102629]
Predicted Effect probably benign
Transcript: ENSMUST00000090558
AA Change: P2875A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: P2875A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090561
SMART Domains Protein: ENSMUSP00000088049
Gene: ENSMUSG00000068744

DomainStartEndE-ValueType
Pfam:GTSE1_N 7 124 4.8e-24 PFAM
low complexity region 131 143 N/A INTRINSIC
low complexity region 222 231 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102629
SMART Domains Protein: ENSMUSP00000099689
Gene: ENSMUSG00000068744

DomainStartEndE-ValueType
Pfam:GTSE1_N 8 108 2e-12 PFAM
low complexity region 131 143 N/A INTRINSIC
low complexity region 222 231 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133216
Predicted Effect probably benign
Transcript: ENSMUST00000147251
AA Change: P863A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: P863A

DomainStartEndE-ValueType
Pfam:GAIN 35 278 5.1e-63 PFAM
GPS 304 357 1.86e-25 SMART
Pfam:7tm_2 362 594 2e-49 PFAM
low complexity region 704 722 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 863 870 N/A INTRINSIC
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,210,235 H225R probably benign Het
Abcc9 T A 6: 142,656,618 I690F probably benign Het
Acp4 A T 7: 44,256,971 D52E probably damaging Het
Adam17 T C 12: 21,343,019 probably benign Het
Adamts15 T C 9: 30,921,576 E221G probably damaging Het
Aoc2 A G 11: 101,325,714 T208A probably benign Het
Apoa4 T G 9: 46,242,737 I212S probably damaging Het
Bptf A T 11: 107,073,385 M1598K probably damaging Het
Camsap3 G A 8: 3,600,680 R209Q probably damaging Het
Ccdc171 C A 4: 83,558,526 probably benign Het
Cenpb A G 2: 131,179,818 V20A probably benign Het
Cfap61 A T 2: 146,143,160 K975* probably null Het
Col9a2 G T 4: 121,039,772 A20S unknown Het
Crnn A T 3: 93,148,896 I330F probably benign Het
Csf3r C A 4: 126,035,827 P381Q probably benign Het
Csmd3 G A 15: 48,673,495 Q104* probably null Het
Ctnna1 G A 18: 35,182,554 probably null Het
Cwf19l2 C T 9: 3,418,761 Q183* probably null Het
Ddx60 T C 8: 61,945,906 Y220H probably benign Het
Dhh T C 15: 98,898,157 Q39R probably benign Het
Dynlrb2 T A 8: 116,515,698 I89N possibly damaging Het
Dytn T C 1: 63,623,043 E645G probably benign Het
Efcab7 A G 4: 99,897,491 T287A probably damaging Het
Eogt A G 6: 97,134,315 V195A probably benign Het
Ep400 G T 5: 110,756,358 P125Q probably damaging Het
Fasn A G 11: 120,811,391 V1815A probably benign Het
Gm4788 T C 1: 139,753,103 S226G probably benign Het
Gm5866 T C 5: 52,582,882 noncoding transcript Het
Gm8674 C A 13: 49,901,948 noncoding transcript Het
Gpat4 G T 8: 23,180,202 H270Q possibly damaging Het
Grik5 A G 7: 25,010,640 L890P probably damaging Het
Gsap A G 5: 21,269,936 N500S probably damaging Het
H2-M10.1 T C 17: 36,325,156 D173G probably benign Het
Igfn1 T A 1: 135,973,502 I413F possibly damaging Het
Ighv1-52 G T 12: 115,145,786 H17N probably benign Het
Kcnu1 T A 8: 25,934,488 D270E possibly damaging Het
Kif16b A C 2: 142,848,339 N274K probably damaging Het
Klk1b11 C T 7: 43,999,022 T151I probably benign Het
Krtap13 A G 16: 88,751,570 F10S probably damaging Het
Large1 A T 8: 72,859,341 I379N probably damaging Het
Lhx8 T C 3: 154,311,695 H301R probably damaging Het
Lrriq3 T C 3: 155,129,384 V252A probably benign Het
Lysmd3 T A 13: 81,669,192 I96N probably damaging Het
Mpeg1 C T 19: 12,461,429 Q84* probably null Het
Myoz1 C T 14: 20,650,654 G165D probably benign Het
Myt1 G A 2: 181,797,620 V312I probably benign Het
Ndufb7 T C 8: 83,566,977 probably benign Het
Numa1 C T 7: 101,977,437 T10M probably damaging Het
Olfr1285 T C 2: 111,409,240 noncoding transcript Het
Olfr130 A T 17: 38,067,266 I32F probably damaging Het
Olfr1316 A T 2: 112,130,558 D84E probably damaging Het
Olfr149 T A 9: 39,702,070 H233L probably benign Het
Olfr390 A C 11: 73,786,964 I9L probably benign Het
Osmr A T 15: 6,827,275 S464T probably benign Het
Pak7 G A 2: 136,083,229 H718Y probably damaging Het
Pan2 T A 10: 128,314,995 probably null Het
Pik3r4 T C 9: 105,669,009 S853P probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polr3gl T A 3: 96,578,479 probably benign Het
Psd2 G A 18: 35,979,810 R186Q possibly damaging Het
Psd4 T C 2: 24,405,438 V868A probably benign Het
Ralgapa2 G T 2: 146,412,084 T852K probably benign Het
Rbm43 T C 2: 51,932,423 probably benign Het
Rps6kl1 C A 12: 85,139,348 G329C probably damaging Het
Scaf11 T C 15: 96,419,542 T714A probably benign Het
Selenoo C A 15: 89,094,305 N310K possibly damaging Het
Sepsecs T C 5: 52,660,661 Q258R probably damaging Het
Sgcz T C 8: 37,526,266 S226G probably benign Het
Slfn5 A G 11: 82,960,928 K627E probably damaging Het
Sos1 A T 17: 80,408,248 F1027I probably damaging Het
Ssh1 C G 5: 113,957,398 V228L possibly damaging Het
Sugp1 C A 8: 70,048,667 P65T probably benign Het
Tas2r106 T A 6: 131,678,816 N24I probably damaging Het
Tex10 T C 4: 48,459,272 E534G possibly damaging Het
Tmem182 C T 1: 40,854,901 T192I possibly damaging Het
Traf7 T A 17: 24,518,744 K51* probably null Het
Trap1 C A 16: 4,044,088 R604L probably damaging Het
Trim6 T A 7: 104,228,240 L179Q probably damaging Het
Ubfd1 T C 7: 122,071,750 S264P probably damaging Het
Upk3bl T C 5: 136,064,191 probably benign Het
Wdfy3 T A 5: 101,868,106 Q2601L possibly damaging Het
Wdr89 A G 12: 75,632,638 Y281H probably damaging Het
Zfp286 A T 11: 62,780,725 M174K probably benign Het
Zmym1 T C 4: 127,051,437 probably null Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
goldeneye UTSW 3 108394919 missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108414062 missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108413402 missense probably benign 0.19
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0730:Celsr2 UTSW 3 108398606 missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108393739 missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108398650 missense probably benign 0.05
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4458:Celsr2 UTSW 3 108394997 missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5135:Celsr2 UTSW 3 108398659 missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null 0.49
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGCTTGGGTTAGCAAG -3'
(R):5'- CAAAGGTGAGTGGAGTCTCTC -3'

Sequencing Primer
(F):5'- CTTGGGTTAGCAAGGACCTCAG -3'
(R):5'- CTCTTGCCGGAGCTATTAGGAC -3'
Posted On2017-01-11