Incidental Mutation 'IGL03098:Trim9'
ID 452986
Institutional Source Beutler Lab
Gene Symbol Trim9
Ensembl Gene ENSMUSG00000021071
Gene Name tripartite motif-containing 9
Synonyms C030048G07Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.406) question?
Stock # IGL03098 (G1)
Quality Score 104
Status Validated
Chromosome 12
Chromosomal Location 70291307-70394388 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70327467 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 390 (I390T)
Ref Sequence ENSEMBL: ENSMUSP00000152147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000167755] [ENSMUST00000221041] [ENSMUST00000221370] [ENSMUST00000223160] [ENSMUST00000222316]
AlphaFold Q8C7M3
Predicted Effect possibly damaging
Transcript: ENSMUST00000110520
AA Change: I390T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: I390T

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Pfam:SPRY 598 702 2.4e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110522
AA Change: I390T

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: I390T

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
low complexity region 591 605 N/A INTRINSIC
Pfam:SPRY 674 776 1.5e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167755
AA Change: I390T

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127081
Gene: ENSMUSG00000021071
AA Change: I390T

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000221041
AA Change: I390T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect unknown
Transcript: ENSMUST00000221294
AA Change: I363T
Predicted Effect possibly damaging
Transcript: ENSMUST00000221370
AA Change: I390T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000223160
AA Change: I390T

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222316
AA Change: I390T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222603
Meta Mutation Damage Score 0.5329 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (44/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Abca15 T C 7: 119,987,499 (GRCm39) probably null Het
Adcy4 T C 14: 56,019,038 (GRCm39) Q173R probably null Het
Arhgef19 A G 4: 140,974,879 (GRCm39) D113G possibly damaging Het
Btbd6 A G 12: 112,942,038 (GRCm39) E501G probably damaging Het
Btnl2 T C 17: 34,584,190 (GRCm39) V371A probably benign Het
Cd84 G T 1: 171,700,267 (GRCm39) R128L possibly damaging Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Dsg3 A T 18: 20,643,422 (GRCm39) probably benign Het
Efnb2 A T 8: 8,713,420 (GRCm39) probably benign Het
Fam24b T C 7: 130,927,977 (GRCm39) S71G probably benign Het
Flacc1 G T 1: 58,730,908 (GRCm39) H49Q probably benign Het
Hgd G A 16: 37,436,607 (GRCm39) C180Y probably benign Het
Hjurp TGGG TTGCGGG 1: 88,194,002 (GRCm39) probably benign Het
Hsd17b7 C T 1: 169,780,649 (GRCm39) E320K probably damaging Het
Kcmf1 A T 6: 72,826,567 (GRCm39) M1K probably null Het
Letm2 T A 8: 26,071,745 (GRCm39) T386S possibly damaging Het
Lvrn A T 18: 47,014,477 (GRCm39) probably null Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Nid2 G A 14: 19,856,006 (GRCm39) D1244N probably damaging Het
Nvl G T 1: 180,921,471 (GRCm39) Q843K probably benign Het
Obi1 T C 14: 104,716,253 (GRCm39) I707V possibly damaging Het
Or1e30 T G 11: 73,678,529 (GRCm39) I255S probably benign Het
Pi4ka A T 16: 17,143,891 (GRCm39) I726N probably damaging Het
Rab25 A T 3: 88,449,567 (GRCm39) C209S probably damaging Het
Rgs6 A T 12: 83,032,150 (GRCm39) I21F probably damaging Het
Rnf10 T C 5: 115,410,426 (GRCm39) D16G probably damaging Het
Rnmt G A 18: 68,439,073 (GRCm39) V61M probably damaging Het
Rrs1 GCTC GC 1: 9,616,328 (GRCm39) probably null Het
Scd4 A T 19: 44,321,931 (GRCm39) M1L possibly damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Sptb A G 12: 76,668,273 (GRCm39) I608T probably damaging Het
Sstr5 A G 17: 25,710,251 (GRCm39) V326A probably benign Het
Sugct T C 13: 17,846,321 (GRCm39) D62G probably damaging Het
Thada C G 17: 84,641,569 (GRCm39) D1306H possibly damaging Het
Thap1 C G 8: 26,652,498 (GRCm39) P79A probably benign Het
Tra2a G A 6: 49,225,969 (GRCm39) S157L probably damaging Het
Trappc10 C T 10: 78,050,520 (GRCm39) R307Q probably damaging Het
Usp24 T C 4: 106,228,230 (GRCm39) V765A probably benign Het
Wdr90 C A 17: 26,078,961 (GRCm39) probably benign Het
Ybey A T 10: 76,304,078 (GRCm39) C41* probably null Het
Other mutations in Trim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Trim9 APN 12 70,393,887 (GRCm39) missense probably damaging 0.98
IGL01618:Trim9 APN 12 70,295,125 (GRCm39) missense probably benign
IGL01794:Trim9 APN 12 70,328,654 (GRCm39) missense probably damaging 1.00
IGL03101:Trim9 APN 12 70,393,428 (GRCm39) missense probably damaging 1.00
IGL03184:Trim9 APN 12 70,297,995 (GRCm39) missense probably damaging 0.99
E0354:Trim9 UTSW 12 70,319,233 (GRCm39) missense probably benign 0.01
R0518:Trim9 UTSW 12 70,393,359 (GRCm39) missense probably damaging 0.99
R0622:Trim9 UTSW 12 70,393,378 (GRCm39) missense probably damaging 1.00
R0941:Trim9 UTSW 12 70,295,037 (GRCm39) missense probably damaging 0.97
R1022:Trim9 UTSW 12 70,298,791 (GRCm39) splice site probably null
R1024:Trim9 UTSW 12 70,298,791 (GRCm39) splice site probably null
R1204:Trim9 UTSW 12 70,393,501 (GRCm39) missense probably damaging 1.00
R1439:Trim9 UTSW 12 70,297,867 (GRCm39) missense probably damaging 1.00
R1530:Trim9 UTSW 12 70,319,202 (GRCm39) missense probably damaging 0.98
R1613:Trim9 UTSW 12 70,295,169 (GRCm39) missense probably damaging 1.00
R1661:Trim9 UTSW 12 70,301,887 (GRCm39) missense probably damaging 0.99
R1665:Trim9 UTSW 12 70,301,887 (GRCm39) missense probably damaging 0.99
R1722:Trim9 UTSW 12 70,295,148 (GRCm39) missense probably benign 0.33
R2097:Trim9 UTSW 12 70,393,933 (GRCm39) missense probably damaging 1.00
R3082:Trim9 UTSW 12 70,301,887 (GRCm39) missense possibly damaging 0.93
R3123:Trim9 UTSW 12 70,295,167 (GRCm39) missense probably damaging 1.00
R3124:Trim9 UTSW 12 70,295,167 (GRCm39) missense probably damaging 1.00
R3125:Trim9 UTSW 12 70,295,167 (GRCm39) missense probably damaging 1.00
R3738:Trim9 UTSW 12 70,297,969 (GRCm39) missense probably damaging 1.00
R4013:Trim9 UTSW 12 70,393,126 (GRCm39) missense probably damaging 1.00
R4017:Trim9 UTSW 12 70,393,126 (GRCm39) missense probably damaging 1.00
R4560:Trim9 UTSW 12 70,393,892 (GRCm39) nonsense probably null
R4734:Trim9 UTSW 12 70,295,047 (GRCm39) missense probably damaging 1.00
R4748:Trim9 UTSW 12 70,295,047 (GRCm39) missense probably damaging 1.00
R4749:Trim9 UTSW 12 70,295,047 (GRCm39) missense probably damaging 1.00
R4777:Trim9 UTSW 12 70,393,845 (GRCm39) missense probably damaging 1.00
R5027:Trim9 UTSW 12 70,393,482 (GRCm39) missense probably damaging 0.96
R5451:Trim9 UTSW 12 70,393,603 (GRCm39) missense probably benign 0.17
R5471:Trim9 UTSW 12 70,393,566 (GRCm39) missense possibly damaging 0.93
R6394:Trim9 UTSW 12 70,301,987 (GRCm39) missense possibly damaging 0.91
R6901:Trim9 UTSW 12 70,393,413 (GRCm39) missense probably damaging 0.96
R7549:Trim9 UTSW 12 70,393,715 (GRCm39) missense probably damaging 1.00
R7690:Trim9 UTSW 12 70,295,117 (GRCm39) missense probably benign
R7895:Trim9 UTSW 12 70,301,961 (GRCm39) missense probably benign 0.03
R8003:Trim9 UTSW 12 70,393,608 (GRCm39) missense probably benign 0.39
R8026:Trim9 UTSW 12 70,337,161 (GRCm39) missense probably benign 0.00
R8223:Trim9 UTSW 12 70,297,789 (GRCm39) missense probably damaging 0.99
R8956:Trim9 UTSW 12 70,393,665 (GRCm39) missense probably damaging 0.97
R9017:Trim9 UTSW 12 70,314,013 (GRCm39) missense probably benign
R9475:Trim9 UTSW 12 70,393,228 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CGTACAACCTTCATCACGGG -3'
(R):5'- ACTGTGGGCCACTCTAGTCATG -3'

Sequencing Primer
(F):5'- ATCACGGGGTCATCCACAGTATTG -3'
(R):5'- GGCCACTCTAGTCATGCCACAG -3'
Posted On 2017-01-24