Incidental Mutation 'IGL03054:Cilp'
ID 453027
Institutional Source Beutler Lab
Gene Symbol Cilp
Ensembl Gene ENSMUSG00000042254
Gene Name cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms C130036G17Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL03054 (G1)
Quality Score 214
Status Validated
Chromosome 9
Chromosomal Location 65172462-65187887 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TGGG to TGG at 65187412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000048762
SMART Domains Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Mucin2_WxxW 55 139 1.9e-24 PFAM
TSP1 152 201 3.09e-10 SMART
low complexity region 233 242 N/A INTRINSIC
IGc2 321 383 4.45e-10 SMART
low complexity region 1154 1170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141382
SMART Domains Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Acsbg3 A G 17: 57,193,528 (GRCm39) T625A possibly damaging Het
Aloxe3 T C 11: 69,020,433 (GRCm39) V159A possibly damaging Het
Atp13a2 T A 4: 140,734,279 (GRCm39) C1134S possibly damaging Het
Ccdc40 G A 11: 119,154,027 (GRCm39) E1100K possibly damaging Het
Ceacam5 A T 7: 17,493,379 (GRCm39) T801S possibly damaging Het
Col4a2 T C 8: 11,498,270 (GRCm39) I1693T probably damaging Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Dab2 G T 15: 6,447,707 (GRCm39) probably benign Het
Dao T C 5: 114,162,963 (GRCm39) L345P probably damaging Het
Dis3l A G 9: 64,217,722 (GRCm39) probably null Het
Egr3 C T 14: 70,316,561 (GRCm39) T124M probably damaging Het
Gng7 G T 10: 80,787,485 (GRCm39) F59L probably damaging Het
Itgb4 C A 11: 115,891,166 (GRCm39) Y1190* probably null Het
Lacc1 T C 14: 77,268,355 (GRCm39) M319V possibly damaging Het
Mapkbp1 A G 2: 119,845,881 (GRCm39) T417A probably damaging Het
Mier3 C T 13: 111,822,848 (GRCm39) probably benign Het
Mlxipl A G 5: 135,162,110 (GRCm39) D569G possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mrpl15 A G 1: 4,855,794 (GRCm39) probably null Het
Neb T C 2: 52,161,334 (GRCm39) N2153D probably damaging Het
Nlrp9c A G 7: 26,081,701 (GRCm39) probably null Het
Npepps C T 11: 97,132,614 (GRCm39) probably benign Het
Or13a17 T G 7: 140,271,623 (GRCm39) S268R probably benign Het
Or1j10 A T 2: 36,266,944 (GRCm39) H52L possibly damaging Het
Or52z12 C A 7: 103,234,047 (GRCm39) H273N probably benign Het
Psmc4 T C 7: 27,746,605 (GRCm39) Y160C probably damaging Het
Rims1 T C 1: 22,360,333 (GRCm39) Y131C probably damaging Het
Riok1 G A 13: 38,231,291 (GRCm39) G183D probably damaging Het
Samd9l T A 6: 3,376,023 (GRCm39) I413F probably damaging Het
Tnfrsf22 A G 7: 143,194,532 (GRCm39) Y132H probably damaging Het
Ttn T A 2: 76,726,104 (GRCm39) probably benign Het
Tulp1 A G 17: 28,578,287 (GRCm39) probably benign Het
Usp15 C A 10: 122,961,836 (GRCm39) probably benign Het
Wdr7 G T 18: 63,958,192 (GRCm39) probably benign Het
Other mutations in Cilp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Cilp APN 9 65,186,265 (GRCm39) missense possibly damaging 0.80
IGL01340:Cilp APN 9 65,183,256 (GRCm39) missense probably damaging 0.99
IGL02330:Cilp APN 9 65,181,804 (GRCm39) splice site probably benign
IGL02729:Cilp APN 9 65,185,372 (GRCm39) missense possibly damaging 0.63
IGL02833:Cilp APN 9 65,185,206 (GRCm39) missense probably benign
IGL02961:Cilp APN 9 65,185,891 (GRCm39) missense possibly damaging 0.88
IGL03137:Cilp APN 9 65,185,450 (GRCm39) missense probably benign
IGL03211:Cilp APN 9 65,187,457 (GRCm39) missense probably benign
IGL03301:Cilp APN 9 65,187,499 (GRCm39) missense probably benign 0.01
IGL03341:Cilp APN 9 65,185,284 (GRCm39) missense probably benign 0.07
ANU05:Cilp UTSW 9 65,186,265 (GRCm39) missense possibly damaging 0.80
IGL02984:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL02988:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL02991:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03014:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03050:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03055:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03097:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03098:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03134:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03138:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03147:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
R0096:Cilp UTSW 9 65,180,952 (GRCm39) missense possibly damaging 0.57
R0219:Cilp UTSW 9 65,176,872 (GRCm39) missense possibly damaging 0.64
R0347:Cilp UTSW 9 65,187,435 (GRCm39) missense probably benign
R0699:Cilp UTSW 9 65,177,608 (GRCm39) missense probably damaging 1.00
R1148:Cilp UTSW 9 65,187,598 (GRCm39) missense possibly damaging 0.96
R1148:Cilp UTSW 9 65,187,598 (GRCm39) missense possibly damaging 0.96
R1155:Cilp UTSW 9 65,176,869 (GRCm39) missense probably benign 0.01
R1544:Cilp UTSW 9 65,183,127 (GRCm39) missense probably benign 0.03
R1584:Cilp UTSW 9 65,186,997 (GRCm39) missense probably damaging 1.00
R1586:Cilp UTSW 9 65,186,997 (GRCm39) missense probably damaging 1.00
R2055:Cilp UTSW 9 65,186,997 (GRCm39) missense probably damaging 1.00
R2069:Cilp UTSW 9 65,185,372 (GRCm39) missense possibly damaging 0.63
R2070:Cilp UTSW 9 65,186,377 (GRCm39) missense probably damaging 1.00
R2414:Cilp UTSW 9 65,181,927 (GRCm39) splice site probably benign
R4284:Cilp UTSW 9 65,185,560 (GRCm39) missense probably damaging 1.00
R4630:Cilp UTSW 9 65,187,162 (GRCm39) missense probably benign 0.17
R4632:Cilp UTSW 9 65,187,162 (GRCm39) missense probably benign 0.17
R4870:Cilp UTSW 9 65,186,980 (GRCm39) missense probably damaging 1.00
R4908:Cilp UTSW 9 65,185,302 (GRCm39) missense probably benign 0.17
R5568:Cilp UTSW 9 65,187,515 (GRCm39) missense probably benign 0.04
R5621:Cilp UTSW 9 65,186,073 (GRCm39) missense possibly damaging 0.71
R5889:Cilp UTSW 9 65,187,625 (GRCm39) missense possibly damaging 0.93
R6645:Cilp UTSW 9 65,186,587 (GRCm39) missense possibly damaging 0.66
R6878:Cilp UTSW 9 65,187,129 (GRCm39) missense probably damaging 1.00
R6982:Cilp UTSW 9 65,187,087 (GRCm39) missense probably damaging 1.00
R7330:Cilp UTSW 9 65,187,527 (GRCm39) missense probably benign
R7967:Cilp UTSW 9 65,185,494 (GRCm39) missense possibly damaging 0.80
R8305:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8306:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8307:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8308:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8386:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8407:Cilp UTSW 9 65,181,898 (GRCm39) missense probably damaging 1.00
R8542:Cilp UTSW 9 65,185,405 (GRCm39) missense probably damaging 1.00
R8794:Cilp UTSW 9 65,186,535 (GRCm39) missense probably benign 0.26
R8951:Cilp UTSW 9 65,180,220 (GRCm39) missense probably benign 0.01
R9060:Cilp UTSW 9 65,186,302 (GRCm39) missense probably benign 0.01
R9257:Cilp UTSW 9 65,174,451 (GRCm39) missense possibly damaging 0.72
R9265:Cilp UTSW 9 65,187,333 (GRCm39) missense probably benign
R9358:Cilp UTSW 9 65,183,269 (GRCm39) missense probably benign
R9401:Cilp UTSW 9 65,185,381 (GRCm39) missense probably damaging 0.98
X0024:Cilp UTSW 9 65,186,925 (GRCm39) missense probably damaging 1.00
X0025:Cilp UTSW 9 65,186,980 (GRCm39) missense probably damaging 1.00
Z1088:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
Z1176:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
Z1177:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTCCTCCAGAATCATGAAGAG -3'
(R):5'- CAGCATCATGAGGCAGAGAC -3'

Sequencing Primer
(F):5'- CCTCCAGAATCATGAAGAGCAATGTG -3'
(R):5'- CATCATGAGGCAGAGACAGTAAG -3'
Posted On 2017-01-24