Incidental Mutation 'IGL03054:Itgb4'
ID453032
Institutional Source Beutler Lab
Gene Symbol Itgb4
Ensembl Gene ENSMUSG00000020758
Gene Nameintegrin beta 4
SynonymsCD104
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL03054 (G1)
Quality Score57
Status Validated
Chromosome11
Chromosomal Location115974709-116008412 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 116000340 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1190 (Y1190*)
Ref Sequence ENSEMBL: ENSMUSP00000127604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021107] [ENSMUST00000068981] [ENSMUST00000106458] [ENSMUST00000106460] [ENSMUST00000106461] [ENSMUST00000169928]
Predicted Effect probably null
Transcript: ENSMUST00000021107
AA Change: Y1190*
SMART Domains Protein: ENSMUSP00000021107
Gene: ENSMUSG00000020758
AA Change: Y1190*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068981
AA Change: Y1194*
SMART Domains Protein: ENSMUSP00000070811
Gene: ENSMUSG00000020758
AA Change: Y1194*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1459 1540 1.79e-12 SMART
FN3 1572 1656 1.7e-13 SMART
low complexity region 1689 1702 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106458
AA Change: Y1194*
SMART Domains Protein: ENSMUSP00000102066
Gene: ENSMUSG00000020758
AA Change: Y1194*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106460
AA Change: Y1194*
SMART Domains Protein: ENSMUSP00000102068
Gene: ENSMUSG00000020758
AA Change: Y1194*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1512 1593 1.79e-12 SMART
FN3 1625 1709 1.7e-13 SMART
low complexity region 1742 1755 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106461
AA Change: Y1194*
SMART Domains Protein: ENSMUSP00000102069
Gene: ENSMUSG00000020758
AA Change: Y1194*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169928
AA Change: Y1190*
SMART Domains Protein: ENSMUSP00000127604
Gene: ENSMUSG00000020758
AA Change: Y1190*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Meta Mutation Damage Score 0.6164 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Integrins are heterodimers comprised of alpha and beta subunits, that are noncovalently associated transmembrane glycoprotein receptors. Different combinations of alpha and beta polypeptides form complexes that vary in their ligand-binding specificities. Integrins mediate cell-matrix or cell-cell adhesion, and transduced signals that regulate gene expression and cell growth. This gene encodes the integrin beta 4 subunit, a receptor for the laminins. This subunit tends to associate with alpha 6 subunit and is likely to play a pivotal role in the biology of invasive carcinoma. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die shortly after birth with extensive detachment of the epidermis and other squamus epithelia. Stratified tissues lack hemidesmosomes and simple epithelia are also defective in adherence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,886,528 T625A possibly damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Aloxe3 T C 11: 69,129,607 V159A possibly damaging Het
Atp13a2 T A 4: 141,006,968 C1134S possibly damaging Het
Ccdc40 G A 11: 119,263,201 E1100K possibly damaging Het
Ceacam5 A T 7: 17,759,454 T801S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col4a2 T C 8: 11,448,270 I1693T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Dab2 G T 15: 6,418,226 probably benign Het
Dao T C 5: 114,024,902 L345P probably damaging Het
Dis3l A G 9: 64,310,440 probably null Het
Egr3 C T 14: 70,079,112 T124M probably damaging Het
Gng7 G T 10: 80,951,651 F59L probably damaging Het
Lacc1 T C 14: 77,030,915 M319V possibly damaging Het
Mapkbp1 A G 2: 120,015,400 T417A probably damaging Het
Mier3 C T 13: 111,686,314 probably benign Het
Mlxipl A G 5: 135,133,256 D569G possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrpl15 A G 1: 4,785,571 probably null Het
Neb T C 2: 52,271,322 N2153D probably damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Npepps C T 11: 97,241,788 probably benign Het
Olfr338 A T 2: 36,376,932 H52L possibly damaging Het
Olfr45 T G 7: 140,691,710 S268R probably benign Het
Olfr617 C A 7: 103,584,840 H273N probably benign Het
Psmc4 T C 7: 28,047,180 Y160C probably damaging Het
Rims1 T C 1: 22,290,109 Y131C probably damaging Het
Riok1 G A 13: 38,047,315 G183D probably damaging Het
Samd9l T A 6: 3,376,023 I413F probably damaging Het
Tnfrsf22 A G 7: 143,640,795 Y132H probably damaging Het
Ttn T A 2: 76,895,760 probably benign Het
Tulp1 A G 17: 28,359,313 probably benign Het
Usp15 C A 10: 123,125,931 probably benign Het
Wdr7 G T 18: 63,825,121 probably benign Het
Other mutations in Itgb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Itgb4 APN 11 115990940 missense probably damaging 1.00
IGL01391:Itgb4 APN 11 115990920 missense probably damaging 1.00
IGL01431:Itgb4 APN 11 116006457 splice site probably benign
IGL01750:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01752:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01756:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01766:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01769:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02188:Itgb4 APN 11 116003387 missense probably benign 0.08
IGL02262:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02293:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02318:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02319:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02338:Itgb4 APN 11 116007969 missense probably damaging 1.00
IGL02734:Itgb4 APN 11 116005966 missense probably benign
IGL02879:Itgb4 APN 11 115994352 missense probably benign 0.05
IGL02889:Itgb4 APN 11 115988905 missense probably damaging 1.00
IGL03183:Itgb4 APN 11 115988724 missense probably damaging 1.00
R0021:Itgb4 UTSW 11 115979627 missense possibly damaging 0.95
R0092:Itgb4 UTSW 11 115979124 missense probably damaging 1.00
R0305:Itgb4 UTSW 11 115979412 missense probably damaging 1.00
R0408:Itgb4 UTSW 11 116007602 missense probably damaging 0.99
R0465:Itgb4 UTSW 11 115979756 missense probably damaging 1.00
R0499:Itgb4 UTSW 11 115979695 missense probably benign 0.00
R0535:Itgb4 UTSW 11 115991009 missense possibly damaging 0.86
R0571:Itgb4 UTSW 11 115979768 missense possibly damaging 0.94
R0613:Itgb4 UTSW 11 115993342 missense probably damaging 0.98
R0838:Itgb4 UTSW 11 115998162 intron probably benign
R1381:Itgb4 UTSW 11 115994337 missense probably benign 0.00
R1451:Itgb4 UTSW 11 115990884 missense probably damaging 1.00
R1459:Itgb4 UTSW 11 115979111 missense probably benign 0.42
R1460:Itgb4 UTSW 11 115984164 missense probably damaging 0.96
R1473:Itgb4 UTSW 11 115984047 missense probably benign 0.01
R1484:Itgb4 UTSW 11 115999799 missense probably benign 0.01
R1593:Itgb4 UTSW 11 115980991 missense probably damaging 1.00
R1623:Itgb4 UTSW 11 115991316 nonsense probably null
R1633:Itgb4 UTSW 11 116007760 missense probably damaging 1.00
R1642:Itgb4 UTSW 11 116007357 missense probably damaging 1.00
R1669:Itgb4 UTSW 11 115991330 missense probably benign 0.07
R1713:Itgb4 UTSW 11 116003489 missense probably damaging 1.00
R1732:Itgb4 UTSW 11 115988918 missense probably damaging 1.00
R1791:Itgb4 UTSW 11 115988520 missense probably damaging 1.00
R1847:Itgb4 UTSW 11 115983764 missense probably benign 0.31
R1902:Itgb4 UTSW 11 115980738 missense probably damaging 0.98
R1945:Itgb4 UTSW 11 115993453 nonsense probably null
R2102:Itgb4 UTSW 11 116005735 missense probably benign 0.23
R2184:Itgb4 UTSW 11 115979624 missense probably damaging 0.96
R2334:Itgb4 UTSW 11 115993435 missense probably damaging 1.00
R2401:Itgb4 UTSW 11 116006563 missense possibly damaging 0.67
R3743:Itgb4 UTSW 11 116003670 missense probably damaging 1.00
R3938:Itgb4 UTSW 11 116005926 missense possibly damaging 0.92
R4134:Itgb4 UTSW 11 116006470 missense probably benign 0.03
R4280:Itgb4 UTSW 11 115990935 missense probably damaging 1.00
R4342:Itgb4 UTSW 11 115988729 missense probably benign 0.01
R4434:Itgb4 UTSW 11 115999814 missense probably benign 0.10
R4505:Itgb4 UTSW 11 115983261 splice site silent
R4585:Itgb4 UTSW 11 115993325 missense probably damaging 1.00
R4586:Itgb4 UTSW 11 115993325 missense probably damaging 1.00
R4601:Itgb4 UTSW 11 116005722 missense probably damaging 1.00
R4921:Itgb4 UTSW 11 116006605 missense probably benign 0.12
R4962:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5027:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5029:Itgb4 UTSW 11 115988591 intron probably benign
R5084:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5085:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5124:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5125:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5150:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5175:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5176:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5179:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5207:Itgb4 UTSW 11 116006539 missense probably damaging 1.00
R5263:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5264:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5334:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5337:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5344:Itgb4 UTSW 11 115989749 missense probably null 0.92
R5391:Itgb4 UTSW 11 115985068 missense probably benign 0.05
R5437:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5440:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5653:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5654:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5655:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5772:Itgb4 UTSW 11 115988432 intron probably benign
R5812:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5813:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5814:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5863:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5864:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5865:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5951:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5954:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5982:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6043:Itgb4 UTSW 11 115979386 missense probably benign 0.30
R6133:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6134:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6135:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6169:Itgb4 UTSW 11 115994276 missense probably damaging 0.98
R6172:Itgb4 UTSW 11 116000411 missense probably benign 0.23
R6255:Itgb4 UTSW 11 115998137 missense possibly damaging 0.83
R6258:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6259:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6260:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6612:Itgb4 UTSW 11 115984071 missense probably benign 0.00
R7037:Itgb4 UTSW 11 116005565 nonsense probably null
X0062:Itgb4 UTSW 11 115993452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACCAATGTCACTTGTAC -3'
(R):5'- ATTGAAAGCCAGCCTCCCTG -3'

Sequencing Primer
(F):5'- TCACTTGTACAAAGGGAGTCCTAGC -3'
(R):5'- GCAGAAAGGGCCCTATTACAG -3'
Posted On2017-01-24