Incidental Mutation 'IGL03054:Ccdc40'
ID453033
Institutional Source Beutler Lab
Gene Symbol Ccdc40
Ensembl Gene ENSMUSG00000039963
Gene Namecoiled-coil domain containing 40
SynonymsB930008I02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.613) question?
Stock #IGL03054 (G1)
Quality Score104
Status Validated
Chromosome11
Chromosomal Location119228572-119265236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119263201 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1100 (E1100K)
Ref Sequence ENSEMBL: ENSMUSP00000039463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000035935] [ENSMUST00000053440] [ENSMUST00000106258] [ENSMUST00000106259]
Predicted Effect probably benign
Transcript: ENSMUST00000026666
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000035935
AA Change: E1100K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963
AA Change: E1100K

DomainStartEndE-ValueType
internal_repeat_1 7 48 1.25e-8 PROSPERO
internal_repeat_1 55 96 1.25e-8 PROSPERO
low complexity region 159 170 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
coiled coil region 349 371 N/A INTRINSIC
coiled coil region 423 447 N/A INTRINSIC
Blast:HisKA 450 519 3e-13 BLAST
Blast:HisKA 574 629 5e-8 BLAST
low complexity region 793 805 N/A INTRINSIC
Pfam:BRE1 830 928 4.2e-20 PFAM
coiled coil region 1044 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053440
SMART Domains Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
internal_repeat_1 79 114 5.57e-8 PROSPERO
internal_repeat_1 111 150 5.57e-8 PROSPERO
low complexity region 229 240 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
coiled coil region 419 441 N/A INTRINSIC
coiled coil region 493 517 N/A INTRINSIC
Blast:HisKA 520 589 2e-13 BLAST
Blast:HisKA 644 699 4e-8 BLAST
low complexity region 863 875 N/A INTRINSIC
Pfam:BRE1 900 998 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106258
SMART Domains Protein: ENSMUSP00000101865
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106259
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155683
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,886,528 T625A possibly damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Aloxe3 T C 11: 69,129,607 V159A possibly damaging Het
Atp13a2 T A 4: 141,006,968 C1134S possibly damaging Het
Ceacam5 A T 7: 17,759,454 T801S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col4a2 T C 8: 11,448,270 I1693T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Dab2 G T 15: 6,418,226 probably benign Het
Dao T C 5: 114,024,902 L345P probably damaging Het
Dis3l A G 9: 64,310,440 probably null Het
Egr3 C T 14: 70,079,112 T124M probably damaging Het
Gng7 G T 10: 80,951,651 F59L probably damaging Het
Itgb4 C A 11: 116,000,340 Y1190* probably null Het
Lacc1 T C 14: 77,030,915 M319V possibly damaging Het
Mapkbp1 A G 2: 120,015,400 T417A probably damaging Het
Mier3 C T 13: 111,686,314 probably benign Het
Mlxipl A G 5: 135,133,256 D569G possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrpl15 A G 1: 4,785,571 probably null Het
Neb T C 2: 52,271,322 N2153D probably damaging Het
Nlrp9c A G 7: 26,382,276 probably null Het
Npepps C T 11: 97,241,788 probably benign Het
Olfr338 A T 2: 36,376,932 H52L possibly damaging Het
Olfr45 T G 7: 140,691,710 S268R probably benign Het
Olfr617 C A 7: 103,584,840 H273N probably benign Het
Psmc4 T C 7: 28,047,180 Y160C probably damaging Het
Rims1 T C 1: 22,290,109 Y131C probably damaging Het
Riok1 G A 13: 38,047,315 G183D probably damaging Het
Samd9l T A 6: 3,376,023 I413F probably damaging Het
Tnfrsf22 A G 7: 143,640,795 Y132H probably damaging Het
Ttn T A 2: 76,895,760 probably benign Het
Tulp1 A G 17: 28,359,313 probably benign Het
Usp15 C A 10: 123,125,931 probably benign Het
Wdr7 G T 18: 63,825,121 probably benign Het
Other mutations in Ccdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccdc40 APN 11 119242719 missense possibly damaging 0.90
IGL01864:Ccdc40 APN 11 119243085 missense probably benign 0.23
IGL01911:Ccdc40 APN 11 119231971 unclassified probably null
IGL02640:Ccdc40 APN 11 119238078 missense probably benign 0.18
IGL03278:Ccdc40 APN 11 119242510 missense probably damaging 1.00
PIT4151001:Ccdc40 UTSW 11 119242451 missense probably damaging 1.00
R0139:Ccdc40 UTSW 11 119264299 missense probably benign 0.00
R0140:Ccdc40 UTSW 11 119264299 missense probably benign 0.00
R0415:Ccdc40 UTSW 11 119232118 missense possibly damaging 0.92
R0617:Ccdc40 UTSW 11 119242804 missense probably damaging 1.00
R1396:Ccdc40 UTSW 11 119231803 missense possibly damaging 0.66
R1531:Ccdc40 UTSW 11 119263189 missense probably benign 0.01
R1751:Ccdc40 UTSW 11 119230696 critical splice donor site probably null
R1767:Ccdc40 UTSW 11 119230696 critical splice donor site probably null
R1870:Ccdc40 UTSW 11 119259904 missense possibly damaging 0.81
R1971:Ccdc40 UTSW 11 119263075 unclassified probably null
R2106:Ccdc40 UTSW 11 119264297 missense probably damaging 1.00
R2370:Ccdc40 UTSW 11 119263117 missense probably benign 0.00
R3421:Ccdc40 UTSW 11 119234779 missense probably benign 0.02
R3746:Ccdc40 UTSW 11 119264426 missense probably benign 0.26
R3749:Ccdc40 UTSW 11 119264426 missense probably benign 0.26
R3871:Ccdc40 UTSW 11 119264281 missense probably damaging 1.00
R4508:Ccdc40 UTSW 11 119242509 missense probably damaging 0.98
R4613:Ccdc40 UTSW 11 119231532 missense probably benign 0.09
R4663:Ccdc40 UTSW 11 119231506 missense probably benign 0.01
R4787:Ccdc40 UTSW 11 119253621 missense possibly damaging 0.74
R4867:Ccdc40 UTSW 11 119231788 missense probably benign
R5237:Ccdc40 UTSW 11 119259976 missense probably benign 0.00
R5661:Ccdc40 UTSW 11 119237927 missense probably benign 0.13
R5678:Ccdc40 UTSW 11 119231572 missense possibly damaging 0.61
R5805:Ccdc40 UTSW 11 119246080 critical splice donor site probably null
R5830:Ccdc40 UTSW 11 119242746 missense probably benign 0.00
R5895:Ccdc40 UTSW 11 119253403 missense probably damaging 1.00
R5932:Ccdc40 UTSW 11 119251012 missense probably damaging 0.98
R6034:Ccdc40 UTSW 11 119243072 missense possibly damaging 0.70
R6034:Ccdc40 UTSW 11 119243072 missense possibly damaging 0.70
R6109:Ccdc40 UTSW 11 119231978 missense probably benign
R6166:Ccdc40 UTSW 11 119232001 missense probably benign
R6336:Ccdc40 UTSW 11 119231993 missense possibly damaging 0.82
R6569:Ccdc40 UTSW 11 119242734 missense probably damaging 1.00
R6884:Ccdc40 UTSW 11 119242739 missense possibly damaging 0.82
R7022:Ccdc40 UTSW 11 119231786 missense possibly damaging 0.82
R7212:Ccdc40 UTSW 11 119264444 missense probably damaging 0.99
S24628:Ccdc40 UTSW 11 119232118 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTGGCTGATCCTTAGCCAGC -3'
(R):5'- TGGTGAACGACCCACAAAGG -3'

Sequencing Primer
(F):5'- CTCTGTCTGCCAAGTGACGTG -3'
(R):5'- CAAAGGATGTGAAGGTGAGTAGGTG -3'
Posted On2017-01-24