Incidental Mutation 'R5106:Rad54l'
ID453043
Institutional Source Beutler Lab
Gene Symbol Rad54l
Ensembl Gene ENSMUSG00000028702
Gene NameRAD54 like (S. cerevisiae)
SynonymsRAD54
MMRRC Submission 042694-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5106 (G1)
Quality Score22
Status Validated
Chromosome4
Chromosomal Location116094264-116123690 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 116099764 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030471] [ENSMUST00000102704] [ENSMUST00000102705]
Predicted Effect probably benign
Transcript: ENSMUST00000030471
SMART Domains Protein: ENSMUSP00000030471
Gene: ENSMUSG00000028703

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 352 382 N/A INTRINSIC
low complexity region 417 429 N/A INTRINSIC
SCOP:d1yrga_ 449 742 4e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102704
SMART Domains Protein: ENSMUSP00000099765
Gene: ENSMUSG00000028702

DomainStartEndE-ValueType
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102705
SMART Domains Protein: ENSMUSP00000099766
Gene: ENSMUSG00000028702

DomainStartEndE-ValueType
Pfam:Rad54_N 10 138 7.8e-9 PFAM
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139147
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily, and shares similarity with Saccharomyces cerevisiae Rad54, a protein known to be involved in the homologous recombination and repair of DNA. This protein has been shown to play a role in homologous recombination related repair of DNA double-strand breaks. The binding of this protein to double-strand DNA induces a DNA topological change, which is thought to facilitate homologous DNA paring, and stimulate DNA recombination. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are sensitive to DNA crosslinking agents and to ionizing radiation and show abnormal definitive hematopoiesis following X-ray treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C1qtnf2 G A 11: 43,486,053 R84Q possibly damaging Het
Carmil2 T A 8: 105,694,006 probably null Het
Cenpf A T 1: 189,683,808 C107S probably benign Het
Cideb T C 14: 55,754,525 M191V probably benign Het
Cope C A 8: 70,310,447 R213S possibly damaging Het
Ctcf T C 8: 105,681,498 probably benign Het
Daam2 T C 17: 49,476,461 Y647C probably damaging Het
Dlg2 T C 7: 92,442,686 Y920H probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Fdps C A 3: 89,099,403 R127L probably damaging Het
G6pd2 C T 5: 61,810,352 T490I probably benign Het
Gm6401 A G 14: 41,965,506 M121T probably damaging Het
Gnl2 T C 4: 125,053,536 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l A G 17: 88,694,645 S310G possibly damaging Het
H2afy A G 13: 56,088,293 V213A possibly damaging Het
Igdcc4 T C 9: 65,124,701 F500L probably damaging Het
Lgr4 A T 2: 109,997,595 H207L probably damaging Het
Llcfc1 A G 6: 41,685,376 M105V probably benign Het
Map2k3 A G 11: 60,941,882 K18E probably damaging Het
Mccc1 T A 3: 35,972,564 D528V probably benign Het
Nedd4l C T 18: 65,193,305 T568M probably damaging Het
Nr3c1 A C 18: 39,486,601 I211S possibly damaging Het
Nudt5 C T 2: 5,854,829 probably benign Het
Olfr1176 T C 2: 88,340,110 Y182H probably benign Het
Olfr704 T A 7: 106,865,388 M136K probably damaging Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr826 A T 10: 130,180,308 S191T probably benign Het
Pcid2 A T 8: 13,079,648 F326I probably damaging Het
Pcnt A T 10: 76,401,444 I1336N probably damaging Het
Pomk T C 8: 25,986,376 D50G probably benign Het
Ppp2r2a T C 14: 67,023,097 Y244C probably damaging Het
Ptprz1 A G 6: 23,000,028 T706A probably benign Het
Raph1 T C 1: 60,533,300 D36G probably damaging Het
Rgs7 A G 1: 175,076,850 S166P possibly damaging Het
Rnf183 C G 4: 62,428,228 R111P probably damaging Het
Rp1l1 A T 14: 64,027,946 D327V probably damaging Het
Rpl3l A G 17: 24,732,437 Y156C probably damaging Het
Slc25a54 G T 3: 109,112,864 C398F probably benign Het
Slc39a2 A G 14: 51,895,531 *310W probably null Het
Slit3 T C 11: 35,612,367 C464R probably damaging Het
Smu1 A T 4: 40,743,104 F345I possibly damaging Het
Ssc5d T A 7: 4,936,665 V700E probably benign Het
Stxbp3 T C 3: 108,794,927 Y521C probably benign Het
Tenm4 T C 7: 96,843,149 S1061P probably damaging Het
Thoc5 T C 11: 4,910,630 S103P probably damaging Het
Tmem221 A G 8: 71,555,878 F173L probably benign Het
Trit1 T C 4: 123,054,313 probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r106 T C 17: 20,279,133 probably null Het
Vmn2r38 C A 7: 9,075,170 V738L possibly damaging Het
Zfp160 T A 17: 21,026,761 H524Q probably damaging Het
Zfp791 T A 8: 85,110,630 K202* probably null Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Zkscan7 T C 9: 122,896,133 probably benign Het
Zwilch A C 9: 64,153,584 F329V probably damaging Het
Other mutations in Rad54l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Rad54l APN 4 116105877 missense probably damaging 1.00
IGL01569:Rad54l APN 4 116098998 missense probably damaging 1.00
IGL02120:Rad54l APN 4 116098984 missense probably benign 0.44
IGL02587:Rad54l APN 4 116105797 missense probably damaging 1.00
IGL02728:Rad54l APN 4 116122949 missense probably benign 0.00
IGL03114:Rad54l APN 4 116098532 missense probably damaging 1.00
R0690:Rad54l UTSW 4 116099750 splice site probably benign
R1179:Rad54l UTSW 4 116111320 missense probably benign 0.14
R1956:Rad54l UTSW 4 116110357 missense probably damaging 0.99
R2875:Rad54l UTSW 4 116101853 missense probably benign 0.00
R2936:Rad54l UTSW 4 116122879 intron probably benign
R4237:Rad54l UTSW 4 116099449 missense probably damaging 1.00
R4344:Rad54l UTSW 4 116097354 missense probably damaging 1.00
R4801:Rad54l UTSW 4 116122924 missense probably null 0.12
R4802:Rad54l UTSW 4 116122924 missense probably null 0.12
R5644:Rad54l UTSW 4 116098947 missense probably benign
R5684:Rad54l UTSW 4 116100563 missense probably damaging 1.00
R5883:Rad54l UTSW 4 116099046 intron probably benign
R5963:Rad54l UTSW 4 116110387 missense probably damaging 1.00
R6035:Rad54l UTSW 4 116097469 missense probably damaging 1.00
R6035:Rad54l UTSW 4 116097469 missense probably damaging 1.00
R6369:Rad54l UTSW 4 116111189 critical splice donor site probably null
R6863:Rad54l UTSW 4 116099669 missense probably damaging 1.00
R7135:Rad54l UTSW 4 116105830 missense probably damaging 1.00
R7318:Rad54l UTSW 4 116110709 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CAGGATAGCTTCAGCACAGAG -3'
(R):5'- ATACTGGCTACACCCTGTGG -3'

Sequencing Primer
(F):5'- GCTTCAGCACAGAGGTAATTTCC -3'
(R):5'- GGAACTTGGGAGGGTGTACC -3'
Posted On2017-01-25