Incidental Mutation 'R5091:Dcaf6'
ID453052
Institutional Source Beutler Lab
Gene Symbol Dcaf6
Ensembl Gene ENSMUSG00000026571
Gene NameDDB1 and CUL4 associated factor 6
SynonymsPC326, 1200006M05Rik, Iqwd1
MMRRC Submission 042680-MU
Accession Numbers

Genbank: NM_028759; MGI: 1921356

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5091 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location165328698-165460475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165330003 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 856 (D856G)
Ref Sequence ENSEMBL: ENSMUSP00000027856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027856] [ENSMUST00000111450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027856
AA Change: D856G

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027856
Gene: ENSMUSG00000026571
AA Change: D856G

DomainStartEndE-ValueType
WD40 40 79 5.77e-5 SMART
WD40 82 124 1.2e-2 SMART
WD40 130 170 2.15e-1 SMART
WD40 184 220 3.33e-1 SMART
WD40 238 281 6.66e-1 SMART
low complexity region 364 374 N/A INTRINSIC
low complexity region 499 510 N/A INTRINSIC
low complexity region 669 676 N/A INTRINSIC
IQ 691 713 1.25e1 SMART
WD40 722 763 3.84e0 SMART
WD40 766 805 1.22e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111450
SMART Domains Protein: ENSMUSP00000107077
Gene: ENSMUSG00000040836

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 261 1.1e-6 PFAM
Pfam:7tm_1 57 337 3e-47 PFAM
low complexity region 476 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193353
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (67/70)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,553,244 S174P probably damaging Het
4931414P19Rik T C 14: 54,585,711 E343G probably damaging Het
9530053A07Rik A C 7: 28,156,958 I2057L probably benign Het
Abca14 T C 7: 120,252,274 V825A probably damaging Het
Abca8b G T 11: 109,936,384 T1466K possibly damaging Het
Adcy8 A G 15: 64,806,704 S467P probably damaging Het
Agbl4 T C 4: 111,119,040 V198A possibly damaging Het
Agpat4 A G 17: 12,198,812 K80R probably benign Het
Akap8 T C 17: 32,316,234 T269A probably benign Het
Ankhd1 A T 18: 36,625,027 I925F possibly damaging Het
Aste1 A G 9: 105,405,004 Y57C probably damaging Het
Axdnd1 A G 1: 156,420,410 S7P possibly damaging Het
BC051019 T A 7: 109,720,582 R91S probably null Het
Cavin2 C A 1: 51,301,239 N358K probably benign Het
Cd2 T C 3: 101,283,039 N196S probably benign Het
Clca3a1 C T 3: 144,730,722 V867I probably benign Het
Col6a4 T A 9: 106,075,063 K545N probably damaging Het
Cps1 T A 1: 67,229,520 probably null Het
Cyp2c65 A T 19: 39,087,565 probably null Het
E130309D02Rik C T 5: 143,307,688 E345K possibly damaging Het
Epcam T C 17: 87,642,152 I181T probably damaging Het
Esrp2 A G 8: 106,132,429 S562P probably damaging Het
Ffar4 A G 19: 38,097,179 D18G probably benign Het
Gen1 C T 12: 11,246,346 V337I probably damaging Het
Gimap8 C T 6: 48,656,647 P467S possibly damaging Het
Gnl3 T A 14: 31,016,846 H82L possibly damaging Het
Grid2 T C 6: 64,076,878 S354P probably benign Het
Ighmbp2 T A 19: 3,265,084 T779S possibly damaging Het
Kif19a C A 11: 114,783,097 T348N probably damaging Het
Lrrc15 T A 16: 30,273,354 N389I probably damaging Het
Mrps26 A G 2: 130,563,966 Y63C probably damaging Het
Myd88 C A 9: 119,337,823 V223F possibly damaging Het
Nox4 T A 7: 87,376,242 W526R probably damaging Het
Nrg2 A T 18: 36,052,785 N300K probably damaging Het
Nsmf T C 2: 25,060,452 probably benign Het
Patl2 A C 2: 122,123,802 H429Q probably benign Het
Pcdhb12 A T 18: 37,435,854 K18* probably null Het
Peg10 T A 6: 4,754,511 D97E probably benign Het
Runx1t1 C T 4: 13,846,830 Q205* probably null Het
Selenon T C 4: 134,547,973 K138R probably damaging Het
Slc13a3 T C 2: 165,420,080 E369G probably benign Het
Sorcs1 A G 19: 50,259,752 probably null Het
Sptbn4 A T 7: 27,369,391 M499K probably damaging Het
Sra1 A T 18: 36,669,959 probably benign Het
Stra6 T C 9: 58,141,146 L174P probably damaging Het
Syngr1 T C 15: 80,115,885 Y66H probably damaging Het
Synpo G T 18: 60,602,759 S466* probably null Het
Tenm3 T A 8: 48,342,308 M595L probably benign Het
Tnks T C 8: 34,841,809 T1099A probably benign Het
Tram1l1 G T 3: 124,321,751 V187F possibly damaging Het
Trappc11 T C 8: 47,512,604 E529G probably benign Het
Usp17la T C 7: 104,860,932 V248A probably damaging Het
Virma T C 4: 11,519,392 Y880H probably benign Het
Vmn1r214 C T 13: 23,035,401 T355I possibly damaging Het
Vmn2r7 T C 3: 64,690,784 K784R possibly damaging Het
Wrap53 C T 11: 69,562,447 W389* probably null Het
Zfp748 A G 13: 67,541,519 S541P probably damaging Het
Other mutations in Dcaf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Dcaf6 APN 1 165338347 splice site probably benign
IGL01377:Dcaf6 APN 1 165388724 missense probably benign 0.01
IGL02027:Dcaf6 APN 1 165424341 missense probably damaging 1.00
IGL02390:Dcaf6 APN 1 165422921 missense possibly damaging 0.50
IGL02754:Dcaf6 APN 1 165338346 critical splice acceptor site probably null
IGL02900:Dcaf6 APN 1 165399775 missense probably damaging 1.00
IGL03119:Dcaf6 APN 1 165339976 missense probably damaging 1.00
IGL03211:Dcaf6 APN 1 165422933 missense possibly damaging 0.55
R0588:Dcaf6 UTSW 1 165420223 missense possibly damaging 0.89
R1494:Dcaf6 UTSW 1 165333373 missense probably damaging 0.99
R1512:Dcaf6 UTSW 1 165352020 missense probably benign 0.22
R1840:Dcaf6 UTSW 1 165399748 missense probably damaging 0.96
R2191:Dcaf6 UTSW 1 165422864 missense probably benign 0.07
R2297:Dcaf6 UTSW 1 165399862 missense probably damaging 1.00
R3082:Dcaf6 UTSW 1 165422852 splice site probably benign
R3861:Dcaf6 UTSW 1 165429269 missense probably damaging 1.00
R3907:Dcaf6 UTSW 1 165424380 nonsense probably null
R4521:Dcaf6 UTSW 1 165390490 missense probably damaging 0.98
R4531:Dcaf6 UTSW 1 165411467 missense probably damaging 1.00
R4906:Dcaf6 UTSW 1 165411463 critical splice donor site probably null
R4916:Dcaf6 UTSW 1 165420205 missense probably damaging 1.00
R4956:Dcaf6 UTSW 1 165388785 missense probably benign 0.00
R5080:Dcaf6 UTSW 1 165420121 missense probably damaging 1.00
R5277:Dcaf6 UTSW 1 165424346 missense probably benign 0.09
R5512:Dcaf6 UTSW 1 165399835 missense possibly damaging 0.84
R5914:Dcaf6 UTSW 1 165351155 missense probably benign
R6004:Dcaf6 UTSW 1 165388685 missense probably benign 0.00
R6239:Dcaf6 UTSW 1 165351270 missense possibly damaging 0.47
R6736:Dcaf6 UTSW 1 165399785 missense possibly damaging 0.77
R7051:Dcaf6 UTSW 1 165424317 missense possibly damaging 0.82
R7110:Dcaf6 UTSW 1 165351968 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCCATACACGGCAAAAGGTTTCAA -3'
(R):5'- CATGGGTGCACATACATAGAATTT -3'

Sequencing Primer
(F):5'- GTTTTACACACTCTCCCAACTCATG -3'
(R):5'- ATCTCTGTGAATTAGAGGCCAGCC -3'
Posted On2017-01-26