Incidental Mutation 'R5161:Atf2'
ID453055
Institutional Source Beutler Lab
Gene Symbol Atf2
Ensembl Gene ENSMUSG00000027104
Gene Nameactivating transcription factor 2
SynonymsD130078H02Rik, mXBP, Creb2, ATF-2, CRE-BP
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location73816509-73892639 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 73829790 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000055833] [ENSMUST00000090802] [ENSMUST00000100009] [ENSMUST00000112007] [ENSMUST00000112010] [ENSMUST00000112016] [ENSMUST00000112017] [ENSMUST00000136958] [ENSMUST00000173010]
Predicted Effect probably null
Transcript: ENSMUST00000055833
SMART Domains Protein: ENSMUSP00000058521
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090802
SMART Domains Protein: ENSMUSP00000088311
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100009
SMART Domains Protein: ENSMUSP00000097588
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112007
SMART Domains Protein: ENSMUSP00000107638
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112010
SMART Domains Protein: ENSMUSP00000107641
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112016
SMART Domains Protein: ENSMUSP00000107647
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
BRLZ 234 298 3.15e-21 SMART
low complexity region 339 351 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112017
SMART Domains Protein: ENSMUSP00000107648
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124737
SMART Domains Protein: ENSMUSP00000114828
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
BRLZ 126 190 3.89e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136958
SMART Domains Protein: ENSMUSP00000118357
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156455
Predicted Effect probably benign
Transcript: ENSMUST00000173010
SMART Domains Protein: ENSMUSP00000133632
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 377 1.32e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184729
Meta Mutation Damage Score 0.53 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in increased postnatal lethality, skeletal development defects, runting, decreased hearing, inner ear and brain abnormalities, hyperactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Atf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Atf2 APN 2 73845503 missense possibly damaging 0.85
IGL01608:Atf2 APN 2 73819078 missense probably damaging 1.00
IGL02112:Atf2 APN 2 73819037 missense probably damaging 1.00
IGL02469:Atf2 APN 2 73846332 missense probably damaging 0.99
IGL02686:Atf2 APN 2 73845500 missense possibly damaging 0.90
IGL03381:Atf2 APN 2 73828668 missense probably benign 0.13
R0020:Atf2 UTSW 2 73846284 missense possibly damaging 0.81
R0020:Atf2 UTSW 2 73846284 missense possibly damaging 0.81
R0045:Atf2 UTSW 2 73829856 missense probably benign 0.02
R0045:Atf2 UTSW 2 73829856 missense probably benign 0.02
R0480:Atf2 UTSW 2 73819156 splice site probably benign
R0732:Atf2 UTSW 2 73845500 missense possibly damaging 0.90
R1188:Atf2 UTSW 2 73845537 missense probably damaging 0.96
R1285:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1287:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1523:Atf2 UTSW 2 73863208 missense probably damaging 1.00
R1622:Atf2 UTSW 2 73853789 splice site probably null
R1731:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1935:Atf2 UTSW 2 73846219 missense probably damaging 1.00
R1939:Atf2 UTSW 2 73846219 missense probably damaging 1.00
R1965:Atf2 UTSW 2 73850898 missense possibly damaging 0.87
R2000:Atf2 UTSW 2 73863240 critical splice acceptor site probably null
R2045:Atf2 UTSW 2 73863208 missense probably damaging 1.00
R2256:Atf2 UTSW 2 73845511 intron probably null
R3147:Atf2 UTSW 2 73850939 synonymous probably null
R3890:Atf2 UTSW 2 73863213 missense probably damaging 1.00
R4680:Atf2 UTSW 2 73828681 splice site probably null
R4715:Atf2 UTSW 2 73823300 missense probably damaging 1.00
R5853:Atf2 UTSW 2 73828469 splice site probably null
X0033:Atf2 UTSW 2 73846281 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AAAGCTCTTGGAAGTGATGCTGAG -3'
(R):5'- AATGGCGTTTGCATTTCAGAG -3'

Sequencing Primer
(F):5'- CTGACTACTAGCATGGGTTCCAAAG -3'
(R):5'- CAGAGATTAAAAGCTGCTTTGACCC -3'
Posted On2017-01-26