Incidental Mutation 'IGL03147:Olfr1225'
ID453102
Institutional Source Beutler Lab
Gene Symbol Olfr1225
Ensembl Gene ENSMUSG00000101918
Gene Nameolfactory receptor 1225
SynonymsMOR233-11, GA_x6K02T2Q125-50650037-50649102
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #IGL03147 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89168380-89174669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89170972 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 80 (M80T)
Ref Sequence ENSEMBL: ENSMUSP00000150915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188861] [ENSMUST00000216961] [ENSMUST00000217054]
Predicted Effect probably benign
Transcript: ENSMUST00000188861
AA Change: M80T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140442
Gene: ENSMUSG00000101918
AA Change: M80T

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
Pfam:7tm_1 39 289 5.5e-24 PFAM
Pfam:7tm_4 138 287 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216961
AA Change: M80T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000217054
AA Change: M80T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 91% (43/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,169,229 probably benign Het
4631405K08Rik T A 1: 193,507,460 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Ano3 A G 2: 110,697,418 S552P probably damaging Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Chek2 A G 5: 110,848,670 D166G probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Deup1 A T 9: 15,610,614 M85K probably damaging Het
Exo1 A G 1: 175,888,788 Y157C probably damaging Het
Ext1 T A 15: 53,088,072 I539F probably damaging Het
Gcn1l1 T C 5: 115,610,858 V1849A possibly damaging Het
Gpr161 A G 1: 165,317,308 T389A probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncoa1 T A 12: 4,259,342 Y1318F probably damaging Het
Pml T C 9: 58,230,043 H491R possibly damaging Het
Rbmxl2 T G 7: 107,209,651 S48A probably benign Het
Rgs6 A G 12: 83,091,846 D318G probably damaging Het
Sfi1 G A 11: 3,186,080 T84I possibly damaging Het
Slc2a2 A G 3: 28,719,370 M275V possibly damaging Het
Sp110 GC GCC 1: 85,591,567 probably null Het
Specc1 T C 11: 62,118,282 V288A probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Srsf11 C T 3: 158,026,740 V118I probably damaging Het
St8sia2 C A 7: 73,966,819 C136F probably damaging Het
Stmn3 A T 2: 181,309,200 I21N possibly damaging Het
Trak2 G A 1: 58,910,063 T526M probably benign Het
Ttn T A 2: 76,711,967 K25231N probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn1r11 A T 6: 57,137,665 I68F probably damaging Het
Wdr92 G A 11: 17,229,845 G282E probably damaging Het
Zfr T A 15: 12,140,552 Y228* probably null Het
Other mutations in Olfr1225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Olfr1225 APN 2 89171089 missense possibly damaging 0.53
IGL03381:Olfr1225 APN 2 89171179 missense possibly damaging 0.49
R0100:Olfr1225 UTSW 2 89171087 missense probably benign 0.00
R0373:Olfr1225 UTSW 2 89170413 missense probably benign 0.02
R0482:Olfr1225 UTSW 2 89170631 missense probably benign 0.37
R0491:Olfr1225 UTSW 2 89170360 missense probably benign 0.07
R0548:Olfr1225 UTSW 2 89170648 missense probably damaging 1.00
R1123:Olfr1225 UTSW 2 89170868 missense possibly damaging 0.89
R1511:Olfr1225 UTSW 2 89170937 missense probably damaging 1.00
R1565:Olfr1225 UTSW 2 89170627 missense probably benign 0.01
R4204:Olfr1225 UTSW 2 89170780 missense probably benign 0.13
R4580:Olfr1225 UTSW 2 89171200 missense probably benign 0.01
R4669:Olfr1225 UTSW 2 89170901 missense probably damaging 1.00
R5137:Olfr1225 UTSW 2 89170400 missense probably benign 0.00
R6391:Olfr1225 UTSW 2 89170598 missense probably benign 0.03
R6396:Olfr1225 UTSW 2 89170690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCCTCCGGTTCATGATG -3'
(R):5'- TGTCACTGAGTTCATATTCCTGGG -3'

Sequencing Primer
(F):5'- CCTCCGGTTCATGATGGAAGAG -3'
(R):5'- GGGACTTTCACAGAACTCAAAAGTTG -3'
Posted On2017-01-27