Incidental Mutation 'IGL03147:Chek2'
ID 453110
Institutional Source Beutler Lab
Gene Symbol Chek2
Ensembl Gene ENSMUSG00000029521
Gene Name checkpoint kinase 2
Synonyms CHK2, Rad53
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL03147 (G1)
Quality Score 88
Status Validated
Chromosome 5
Chromosomal Location 110987845-111022011 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110996536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000143558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066160] [ENSMUST00000199937]
AlphaFold Q9Z265
Predicted Effect probably damaging
Transcript: ENSMUST00000066160
AA Change: D166G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 5.14e-3 SMART
S_TKc 224 490 7.35e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199937
AA Change: D166G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 2.6e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200630
Meta Mutation Damage Score 0.8297 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 91% (39/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutation of this gene does not increase tumor incidence. Cells from the thymus, central nervous system (CNS), hair follicles, and skin are resistant to ionizing radiation- and gamma irradiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Acan A G 7: 78,740,804 (GRCm39) E390G probably damaging Het
Ano3 A G 2: 110,527,763 (GRCm39) S552P probably damaging Het
Ccser1 A G 6: 61,289,144 (GRCm39) S436G probably benign Het
Cilp TGGG TGG 9: 65,187,412 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Deup1 A T 9: 15,521,910 (GRCm39) M85K probably damaging Het
Dnaaf10 G A 11: 17,179,845 (GRCm39) G282E probably damaging Het
Exo1 A G 1: 175,716,354 (GRCm39) Y157C probably damaging Het
Ext1 T A 15: 52,951,468 (GRCm39) I539F probably damaging Het
Gcn1 T C 5: 115,748,917 (GRCm39) V1849A possibly damaging Het
Gpr161 A G 1: 165,144,877 (GRCm39) T389A probably benign Het
Hjurp TGGG TTGCGGG 1: 88,194,002 (GRCm39) probably benign Het
Mir205hg T A 1: 193,189,768 (GRCm39) noncoding transcript Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Muc6 G A 7: 141,218,313 (GRCm39) S2120F possibly damaging Het
Ncoa1 T A 12: 4,309,342 (GRCm39) Y1318F probably damaging Het
Or4c120 A G 2: 89,001,316 (GRCm39) M80T probably benign Het
Pml T C 9: 58,137,326 (GRCm39) H491R possibly damaging Het
Rbmxl2 T G 7: 106,808,858 (GRCm39) S48A probably benign Het
Rgs6 A G 12: 83,138,620 (GRCm39) D318G probably damaging Het
Rmc1 T C 18: 12,302,286 (GRCm39) probably benign Het
Sfi1 G A 11: 3,136,080 (GRCm39) T84I possibly damaging Het
Slc2a2 A G 3: 28,773,519 (GRCm39) M275V possibly damaging Het
Sp110 GC GCC 1: 85,519,288 (GRCm39) probably null Het
Specc1 T C 11: 62,009,108 (GRCm39) V288A probably benign Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Srsf11 C T 3: 157,732,377 (GRCm39) V118I probably damaging Het
St8sia2 C A 7: 73,616,567 (GRCm39) C136F probably damaging Het
Stmn3 A T 2: 180,950,993 (GRCm39) I21N possibly damaging Het
Trak2 G A 1: 58,949,222 (GRCm39) T526M probably benign Het
Ttn T A 2: 76,542,311 (GRCm39) K25231N probably damaging Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn1r11 A T 6: 57,114,650 (GRCm39) I68F probably damaging Het
Zfr T A 15: 12,140,638 (GRCm39) Y228* probably null Het
Other mutations in Chek2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Chek2 APN 5 110,996,536 (GRCm39) missense probably damaging 1.00
IGL01830:Chek2 APN 5 111,021,374 (GRCm39) missense probably benign
IGL01943:Chek2 APN 5 110,989,093 (GRCm39) unclassified probably benign
IGL02319:Chek2 APN 5 111,014,877 (GRCm39) missense possibly damaging 0.88
PIT4520001:Chek2 UTSW 5 111,011,195 (GRCm39) missense probably damaging 1.00
R1484:Chek2 UTSW 5 110,996,553 (GRCm39) missense probably damaging 1.00
R1486:Chek2 UTSW 5 110,989,093 (GRCm39) unclassified probably benign
R1732:Chek2 UTSW 5 111,019,968 (GRCm39) missense probably benign 0.26
R2041:Chek2 UTSW 5 110,996,530 (GRCm39) missense probably damaging 1.00
R2071:Chek2 UTSW 5 110,989,112 (GRCm39) unclassified probably benign
R2873:Chek2 UTSW 5 111,011,202 (GRCm39) nonsense probably null
R2935:Chek2 UTSW 5 111,015,886 (GRCm39) missense probably damaging 1.00
R3899:Chek2 UTSW 5 111,013,479 (GRCm39) splice site probably benign
R4662:Chek2 UTSW 5 111,014,908 (GRCm39) missense probably damaging 1.00
R4748:Chek2 UTSW 5 111,003,705 (GRCm39) splice site probably null
R5358:Chek2 UTSW 5 110,989,148 (GRCm39) unclassified probably benign
R5582:Chek2 UTSW 5 111,015,901 (GRCm39) missense probably damaging 0.96
R5594:Chek2 UTSW 5 111,003,700 (GRCm39) critical splice donor site probably null
R6526:Chek2 UTSW 5 110,996,556 (GRCm39) missense probably damaging 1.00
R6972:Chek2 UTSW 5 111,003,705 (GRCm39) splice site probably null
R7232:Chek2 UTSW 5 111,008,781 (GRCm39) missense probably damaging 1.00
R7338:Chek2 UTSW 5 111,021,380 (GRCm39) missense probably benign
R7395:Chek2 UTSW 5 111,019,974 (GRCm39) critical splice donor site probably null
R7714:Chek2 UTSW 5 110,989,319 (GRCm39) missense probably benign 0.10
R7743:Chek2 UTSW 5 110,987,916 (GRCm39) critical splice donor site probably null
R8290:Chek2 UTSW 5 111,008,766 (GRCm39) missense possibly damaging 0.70
R8297:Chek2 UTSW 5 110,996,302 (GRCm39) missense probably damaging 1.00
R8719:Chek2 UTSW 5 111,014,908 (GRCm39) missense probably damaging 0.98
R8898:Chek2 UTSW 5 111,011,175 (GRCm39) missense probably benign 0.00
R8906:Chek2 UTSW 5 111,013,458 (GRCm39) utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- GTACCGGACTTACAGCAAGAAG -3'
(R):5'- TGGATGCTACTGAACACTGAC -3'

Sequencing Primer
(F):5'- GCAAGAAGCATTTTCGTATTTTCAGG -3'
(R):5'- TATTAAAGCATAACTGACAGAGACAC -3'
Posted On 2017-01-27