Incidental Mutation 'IGL03147:Chek2'
ID453110
Institutional Source Beutler Lab
Gene Symbol Chek2
Ensembl Gene ENSMUSG00000029521
Gene Namecheckpoint kinase 2
SynonymsRad53, CHK2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03147 (G1)
Quality Score88
Status Validated
Chromosome5
Chromosomal Location110839979-110874145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110848670 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000143558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066160] [ENSMUST00000199937]
Predicted Effect probably damaging
Transcript: ENSMUST00000066160
AA Change: D166G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 5.14e-3 SMART
S_TKc 224 490 7.35e-104 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199937
AA Change: D166G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 2.6e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200630
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 91% (39/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutation of this gene does not increase tumor incidence. Cells from the thymus, central nervous system (CNS), hair follicles, and skin are resistant to ionizing radiation- and gamma irradiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,169,229 probably benign Het
4631405K08Rik T A 1: 193,507,460 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Ano3 A G 2: 110,697,418 S552P probably damaging Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Deup1 A T 9: 15,610,614 M85K probably damaging Het
Exo1 A G 1: 175,888,788 Y157C probably damaging Het
Ext1 T A 15: 53,088,072 I539F probably damaging Het
Gcn1l1 T C 5: 115,610,858 V1849A possibly damaging Het
Gpr161 A G 1: 165,317,308 T389A probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncoa1 T A 12: 4,259,342 Y1318F probably damaging Het
Olfr1225 A G 2: 89,170,972 M80T probably benign Het
Pml T C 9: 58,230,043 H491R possibly damaging Het
Rbmxl2 T G 7: 107,209,651 S48A probably benign Het
Rgs6 A G 12: 83,091,846 D318G probably damaging Het
Sfi1 G A 11: 3,186,080 T84I possibly damaging Het
Slc2a2 A G 3: 28,719,370 M275V possibly damaging Het
Sp110 GC GCC 1: 85,591,567 probably null Het
Specc1 T C 11: 62,118,282 V288A probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Srsf11 C T 3: 158,026,740 V118I probably damaging Het
St8sia2 C A 7: 73,966,819 C136F probably damaging Het
Stmn3 A T 2: 181,309,200 I21N possibly damaging Het
Trak2 G A 1: 58,910,063 T526M probably benign Het
Ttn T A 2: 76,711,967 K25231N probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn1r11 A T 6: 57,137,665 I68F probably damaging Het
Wdr92 G A 11: 17,229,845 G282E probably damaging Het
Zfr T A 15: 12,140,552 Y228* probably null Het
Other mutations in Chek2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Chek2 APN 5 110848670 missense probably damaging 1.00
IGL01830:Chek2 APN 5 110873508 missense probably benign
IGL01943:Chek2 APN 5 110841227 unclassified probably benign
IGL02319:Chek2 APN 5 110867011 missense possibly damaging 0.88
PIT4520001:Chek2 UTSW 5 110863329 missense probably damaging 1.00
R1484:Chek2 UTSW 5 110848687 missense probably damaging 1.00
R1486:Chek2 UTSW 5 110841227 unclassified probably benign
R1732:Chek2 UTSW 5 110872102 missense probably benign 0.26
R2041:Chek2 UTSW 5 110848664 missense probably damaging 1.00
R2071:Chek2 UTSW 5 110841246 unclassified probably benign
R2873:Chek2 UTSW 5 110863336 nonsense probably null
R2935:Chek2 UTSW 5 110868020 missense probably damaging 1.00
R3899:Chek2 UTSW 5 110865613 splice site probably benign
R4662:Chek2 UTSW 5 110867042 missense probably damaging 1.00
R4748:Chek2 UTSW 5 110855839 splice site probably null
R5358:Chek2 UTSW 5 110841282 unclassified probably benign
R5582:Chek2 UTSW 5 110868035 missense probably damaging 0.96
R5594:Chek2 UTSW 5 110855834 critical splice donor site probably null
R6526:Chek2 UTSW 5 110848690 missense probably damaging 1.00
R6972:Chek2 UTSW 5 110855839 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTACCGGACTTACAGCAAGAAG -3'
(R):5'- TGGATGCTACTGAACACTGAC -3'

Sequencing Primer
(F):5'- GCAAGAAGCATTTTCGTATTTTCAGG -3'
(R):5'- TATTAAAGCATAACTGACAGAGACAC -3'
Posted On2017-01-27