Incidental Mutation 'IGL03147:Ccser1'
ID453113
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Namecoiled-coil serine rich 1
Synonyms6230405M12Rik, C130092O11Rik, Fam190a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #IGL03147 (G1)
Quality Score201
Status Validated
Chromosome6
Chromosomal Location61180324-62382865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61312160 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 436 (S436G)
Ref Sequence ENSEMBL: ENSMUSP00000122894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214]
Predicted Effect probably benign
Transcript: ENSMUST00000045522
AA Change: S436G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: S436G

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126214
AA Change: S436G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: S436G

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147576
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 91% (43/47)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,169,229 probably benign Het
4631405K08Rik T A 1: 193,507,460 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Ano3 A G 2: 110,697,418 S552P probably damaging Het
Chek2 A G 5: 110,848,670 D166G probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Deup1 A T 9: 15,610,614 M85K probably damaging Het
Exo1 A G 1: 175,888,788 Y157C probably damaging Het
Ext1 T A 15: 53,088,072 I539F probably damaging Het
Gcn1l1 T C 5: 115,610,858 V1849A possibly damaging Het
Gpr161 A G 1: 165,317,308 T389A probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncoa1 T A 12: 4,259,342 Y1318F probably damaging Het
Olfr1225 A G 2: 89,170,972 M80T probably benign Het
Pml T C 9: 58,230,043 H491R possibly damaging Het
Rbmxl2 T G 7: 107,209,651 S48A probably benign Het
Rgs6 A G 12: 83,091,846 D318G probably damaging Het
Sfi1 G A 11: 3,186,080 T84I possibly damaging Het
Slc2a2 A G 3: 28,719,370 M275V possibly damaging Het
Sp110 GC GCC 1: 85,591,567 probably null Het
Specc1 T C 11: 62,118,282 V288A probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Srsf11 C T 3: 158,026,740 V118I probably damaging Het
St8sia2 C A 7: 73,966,819 C136F probably damaging Het
Stmn3 A T 2: 181,309,200 I21N possibly damaging Het
Trak2 G A 1: 58,910,063 T526M probably benign Het
Ttn T A 2: 76,711,967 K25231N probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn1r11 A T 6: 57,137,665 I68F probably damaging Het
Wdr92 G A 11: 17,229,845 G282E probably damaging Het
Zfr T A 15: 12,140,552 Y228* probably null Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62380142 missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61810665 nonsense probably null
IGL01012:Ccser1 APN 6 61638490 missense probably benign 0.01
IGL01391:Ccser1 APN 6 61638521 splice site probably benign
IGL01643:Ccser1 APN 6 61311855 missense probably benign 0.01
IGL01767:Ccser1 APN 6 61718152 missense probably benign 0.03
IGL02081:Ccser1 APN 6 61311168 nonsense probably null
IGL02152:Ccser1 APN 6 61311708 missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61311292 missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62379831 missense probably damaging 0.99
R0020:Ccser1 UTSW 6 61313804 missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61423061 missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62380106 missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62380032 missense probably benign 0.00
R1650:Ccser1 UTSW 6 61638490 missense probably benign 0.01
R1653:Ccser1 UTSW 6 61311465 missense probably benign 0.00
R1913:Ccser1 UTSW 6 62379894 missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61313646 splice site probably benign
R2030:Ccser1 UTSW 6 61311563 missense probably benign
R2056:Ccser1 UTSW 6 61422952 splice site probably null
R2268:Ccser1 UTSW 6 61570843 missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61422960 missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61311584 missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61311926 missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61311501 missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61718191 missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61311366 missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R5221:Ccser1 UTSW 6 61312091 missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61311666 missense probably benign 0.00
R5604:Ccser1 UTSW 6 61313804 missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61311276 missense probably benign 0.00
R5970:Ccser1 UTSW 6 61311242 missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 61373962 missense probably damaging 0.96
R6257:Ccser1 UTSW 6 62379785 missense probably benign
R6375:Ccser1 UTSW 6 61311168 nonsense probably null
R6703:Ccser1 UTSW 6 61638511 nonsense probably null
R6930:Ccser1 UTSW 6 62380025 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCCCATCATCAAAGAGGAG -3'
(R):5'- AGTGGAGTTTCTGTCCTTCCAC -3'

Sequencing Primer
(F):5'- CATCAAAGAGGAGAGAGCCCCTTG -3'
(R):5'- ACCTCCTTTTCAGGTCAGAATAGCAG -3'
Posted On2017-01-27