Incidental Mutation 'IGL03147:Wdr92'
ID453125
Institutional Source Beutler Lab
Gene Symbol Wdr92
Ensembl Gene ENSMUSG00000078970
Gene NameWD repeat domain 92
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #IGL03147 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location17182107-17233796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17229845 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 282 (G282E)
Ref Sequence ENSEMBL: ENSMUSP00000040938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046955]
Predicted Effect probably damaging
Transcript: ENSMUST00000046955
AA Change: G282E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040938
Gene: ENSMUSG00000078970
AA Change: G282E

DomainStartEndE-ValueType
WD40 55 96 6.88e0 SMART
WD40 100 145 5.15e-2 SMART
Blast:WD40 149 196 8e-27 BLAST
WD40 199 240 2.54e2 SMART
WD40 246 288 2.06e0 SMART
WD40 310 350 7.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151431
Meta Mutation Damage Score 0.0448 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 91% (39/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two WD40 repeat domains thought to be involved in an apoptosis via activation of caspase-3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,169,229 probably benign Het
4631405K08Rik T A 1: 193,507,460 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Ano3 A G 2: 110,697,418 S552P probably damaging Het
Ccser1 A G 6: 61,312,160 S436G probably benign Het
Chek2 A G 5: 110,848,670 D166G probably damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Deup1 A T 9: 15,610,614 M85K probably damaging Het
Exo1 A G 1: 175,888,788 Y157C probably damaging Het
Ext1 T A 15: 53,088,072 I539F probably damaging Het
Gcn1l1 T C 5: 115,610,858 V1849A possibly damaging Het
Gpr161 A G 1: 165,317,308 T389A probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Ncoa1 T A 12: 4,259,342 Y1318F probably damaging Het
Olfr1225 A G 2: 89,170,972 M80T probably benign Het
Pml T C 9: 58,230,043 H491R possibly damaging Het
Rbmxl2 T G 7: 107,209,651 S48A probably benign Het
Rgs6 A G 12: 83,091,846 D318G probably damaging Het
Sfi1 G A 11: 3,186,080 T84I possibly damaging Het
Slc2a2 A G 3: 28,719,370 M275V possibly damaging Het
Sp110 GC GCC 1: 85,591,567 probably null Het
Specc1 T C 11: 62,118,282 V288A probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Srsf11 C T 3: 158,026,740 V118I probably damaging Het
St8sia2 C A 7: 73,966,819 C136F probably damaging Het
Stmn3 A T 2: 181,309,200 I21N possibly damaging Het
Trak2 G A 1: 58,910,063 T526M probably benign Het
Ttn T A 2: 76,711,967 K25231N probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn1r11 A T 6: 57,137,665 I68F probably damaging Het
Zfr T A 15: 12,140,552 Y228* probably null Het
Other mutations in Wdr92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Wdr92 APN 11 17232790 missense probably benign
IGL01801:Wdr92 APN 11 17219015 missense probably benign 0.00
IGL02573:Wdr92 APN 11 17212136 missense possibly damaging 0.92
IGL02985:Wdr92 APN 11 17229845 missense probably damaging 1.00
IGL03148:Wdr92 APN 11 17229845 missense probably damaging 1.00
R0244:Wdr92 UTSW 11 17229851 missense probably damaging 1.00
R0276:Wdr92 UTSW 11 17229821 missense probably benign 0.33
R1013:Wdr92 UTSW 11 17228183 missense probably damaging 1.00
R1660:Wdr92 UTSW 11 17227183 missense probably benign 0.00
R2030:Wdr92 UTSW 11 17229832 missense probably benign
R4663:Wdr92 UTSW 11 17232853 missense probably benign 0.01
R4676:Wdr92 UTSW 11 17229794 missense probably benign 0.00
R4822:Wdr92 UTSW 11 17227165 missense probably damaging 1.00
R5328:Wdr92 UTSW 11 17222220 missense probably damaging 0.97
R5439:Wdr92 UTSW 11 17212031 missense possibly damaging 0.46
R5473:Wdr92 UTSW 11 17224591 missense probably damaging 0.99
R5642:Wdr92 UTSW 11 17227263 missense possibly damaging 0.89
R5771:Wdr92 UTSW 11 17224638 missense probably benign 0.00
R6680:Wdr92 UTSW 11 17229857 missense probably damaging 1.00
R6889:Wdr92 UTSW 11 17222309 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTACTCCTCAGCAAAACTGC -3'
(R):5'- TATTGTGTCAGAAAAGGGCAAC -3'

Sequencing Primer
(F):5'- CTGCTGGCTAAAATTAAAGCAAC -3'
(R):5'- ATGAGCATCCTGGCATTG -3'
Posted On2017-01-27