Incidental Mutation 'R5125:Ei24'
ID453136
Institutional Source Beutler Lab
Gene Symbol Ei24
Ensembl Gene ENSMUSG00000062762
Gene Nameetoposide induced 2.4 mRNA
SynonymsPIG8
MMRRC Submission 042713-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5125 (G1)
Quality Score43
Status Validated
Chromosome9
Chromosomal Location36779159-36797393 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 36782446 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115086] [ENSMUST00000163192] [ENSMUST00000184395]
Predicted Effect probably benign
Transcript: ENSMUST00000115086
SMART Domains Protein: ENSMUSP00000110738
Gene: ENSMUSG00000062762

DomainStartEndE-ValueType
Pfam:EI24 61 290 2.5e-48 PFAM
low complexity region 331 339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163192
SMART Domains Protein: ENSMUSP00000132270
Gene: ENSMUSG00000062762

DomainStartEndE-ValueType
low complexity region 55 71 N/A INTRINSIC
Pfam:EI24 77 289 3.8e-24 PFAM
low complexity region 331 339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183430
Predicted Effect probably benign
Transcript: ENSMUST00000184235
Predicted Effect probably benign
Transcript: ENSMUST00000184395
SMART Domains Protein: ENSMUSP00000139150
Gene: ENSMUSG00000062762

DomainStartEndE-ValueType
Pfam:EI24 58 181 4.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185124
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative tumor suppressor and has higher expression in p53-expressing cells than in control cells and is an immediate-early induction target of p53-mediated apoptosis. The encoded protein may suppress cell growth by inducing apoptotic cell death through the caspase 9 and mitochondrial pathways. This gene is located on human chromosome 11q24, a region frequently altered in cancers. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 1, 3, 7, and 8. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted allele do not survive to the neonatal stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abt1 G T 13: 23,422,649 A94E possibly damaging Het
Carmil2 G T 8: 105,696,889 G1207V probably damaging Het
Cyp2c66 A G 19: 39,171,029 Y308C probably damaging Het
Dcc A G 18: 71,456,877 F683L probably benign Het
Denr A T 5: 123,927,081 I166F probably damaging Het
Dhx29 T G 13: 112,932,600 S155A possibly damaging Het
Dsg1b G A 18: 20,397,503 G405E probably damaging Het
Exo5 A T 4: 120,921,537 probably null Het
Gm15922 T A 7: 3,739,397 K44* probably null Het
Gm7356 T C 17: 14,001,314 D151G probably damaging Het
Grin1 T C 2: 25,296,827 probably benign Het
Grin2b C T 6: 135,923,299 V195M possibly damaging Het
Hephl1 T A 9: 15,086,172 K399N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kmt2c A G 5: 25,284,381 V4520A probably damaging Het
Lair1 G A 7: 4,010,489 T82I possibly damaging Het
Lmx1a C T 1: 167,830,687 S213L possibly damaging Het
Ly6g6d A G 17: 35,074,442 I8T possibly damaging Het
Mcm4 T A 16: 15,635,303 D174V probably benign Het
Mcph1 T A 8: 18,607,326 D60E probably damaging Het
Med12l G A 3: 59,267,214 G1851D possibly damaging Het
Olfr156 T A 4: 43,820,480 I294F probably benign Het
Olfr868 T A 9: 20,101,192 C144* probably null Het
P2rx2 G A 5: 110,342,651 T66I possibly damaging Het
Pcdh15 A G 10: 74,584,080 E1197G probably damaging Het
Ppwd1 A T 13: 104,220,435 S191T probably benign Het
Rbm39 A T 2: 156,162,865 M184K probably damaging Het
Reln A G 5: 21,913,241 V2935A possibly damaging Het
Robo4 T C 9: 37,407,960 W535R probably damaging Het
Rsf1 A G 7: 97,661,872 D603G possibly damaging Het
Sh3rf3 C G 10: 59,131,190 P785A probably benign Het
Slc22a26 T C 19: 7,790,175 T289A possibly damaging Het
Slc24a3 T C 2: 145,518,847 V120A possibly damaging Het
Sost C T 11: 101,963,941 G181R probably damaging Het
Sp2 A G 11: 96,955,838 F554L probably benign Het
Stim2 T C 5: 54,110,597 S87P probably damaging Het
Tcrg-C4 A G 13: 19,344,762 probably benign Het
Tecta T C 9: 42,375,185 D725G probably damaging Het
Ube4b T C 4: 149,342,992 M900V probably damaging Het
Ugt2b38 A G 5: 87,411,812 M407T probably damaging Het
Vmn1r87 G T 7: 13,131,865 A165E possibly damaging Het
Zc3h6 A G 2: 129,014,479 H493R possibly damaging Het
Zfhx2 A T 14: 55,074,775 F154Y probably benign Het
Zfp729a A G 13: 67,637,645 probably null Het
Zfp976 A G 7: 42,612,501 probably null Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Znfx1 A T 2: 167,046,939 V783E possibly damaging Het
Other mutations in Ei24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Ei24 APN 9 36784478 nonsense probably null
IGL00954:Ei24 APN 9 36789870 missense probably damaging 0.96
IGL01336:Ei24 APN 9 36786481 critical splice donor site probably null
IGL01940:Ei24 APN 9 36782391 missense probably damaging 1.00
IGL02112:Ei24 APN 9 36782342 missense probably damaging 0.99
IGL02328:Ei24 APN 9 36785531 critical splice donor site probably null
IGL03251:Ei24 APN 9 36780109 makesense probably null
PIT4378001:Ei24 UTSW 9 36786024 missense probably damaging 1.00
R0673:Ei24 UTSW 9 36788255 critical splice acceptor site probably null
R2047:Ei24 UTSW 9 36780163 missense probably benign 0.03
R2280:Ei24 UTSW 9 36782339 critical splice donor site probably null
R4863:Ei24 UTSW 9 36784565 missense probably damaging 1.00
R5999:Ei24 UTSW 9 36793307 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CATGGGGTTATCACAGCAATAGTAAG -3'
(R):5'- GTACCAGCATGTTACATCATTTGACC -3'

Sequencing Primer
(F):5'- GTTATCACAGCAATAGTAAGTAACCC -3'
(R):5'- GCCTCCTGGAGGAAAATA -3'
Posted On2017-01-27