Incidental Mutation 'IGL03134:Cops7b'
ID453142
Institutional Source Beutler Lab
Gene Symbol Cops7b
Ensembl Gene ENSMUSG00000026240
Gene NameCOP9 signalosome subunit 7B
SynonymsCOP9 complex S7b, D1Wsu66e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #IGL03134 (G1)
Quality Score174
Status Validated
Chromosome1
Chromosomal Location86582904-86609375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86592334 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 69 (L69Q)
Ref Sequence ENSEMBL: ENSMUSP00000119807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027446] [ENSMUST00000121534] [ENSMUST00000122884] [ENSMUST00000138280] [ENSMUST00000149542]
Predicted Effect probably damaging
Transcript: ENSMUST00000027446
AA Change: L69Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027446
Gene: ENSMUSG00000026240
AA Change: L69Q

DomainStartEndE-ValueType
PINT 87 177 2.07e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121534
AA Change: L69Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113587
Gene: ENSMUSG00000026240
AA Change: L69Q

DomainStartEndE-ValueType
PINT 87 177 2.07e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122884
AA Change: L69Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119807
Gene: ENSMUSG00000026240
AA Change: L69Q

DomainStartEndE-ValueType
PDB:3CHM|A 4 78 4e-9 PDB
Blast:PINT 30 54 7e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127219
Predicted Effect probably benign
Transcript: ENSMUST00000138280
SMART Domains Protein: ENSMUSP00000115056
Gene: ENSMUSG00000026240

DomainStartEndE-ValueType
Blast:PINT 30 54 9e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149542
SMART Domains Protein: ENSMUSP00000122317
Gene: ENSMUSG00000026240

DomainStartEndE-ValueType
low complexity region 137 148 N/A INTRINSIC
Meta Mutation Damage Score 0.444 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414J04Rik A T 11: 21,507,249 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Afdn C T 17: 13,846,286 T580I probably benign Het
Ankfy1 G T 11: 72,712,185 L13F probably damaging Het
Arhgap12 T C 18: 6,111,936 T143A probably benign Het
Arsi T G 18: 60,917,352 W436G probably damaging Het
Bcl2l10 C T 9: 75,348,198 T99M probably damaging Het
C77080 A G 4: 129,222,487 S783P possibly damaging Het
Cacna1a A G 8: 84,559,087 Q740R probably damaging Het
Cacna1g A G 11: 94,459,825 F398S probably damaging Het
Ccrl2 A C 9: 111,055,657 Y258D probably damaging Het
Cemip T A 7: 83,999,237 D38V probably damaging Het
Chd6 C G 2: 160,965,483 C1937S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col1a2 T G 6: 4,521,387 probably benign Het
Col4a1 T C 8: 11,240,069 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Ddx3y T A Y: 1,278,949 D163V possibly damaging Het
Dnajc19 A G 3: 34,078,735 probably benign Het
Fam160b2 T C 14: 70,588,709 T288A possibly damaging Het
G2e3 T A 12: 51,364,030 probably benign Het
Gimap7 A G 6: 48,723,501 N7S probably benign Het
Gkap1 G A 13: 58,263,932 probably benign Het
Gm3404 G A 5: 146,526,896 R117Q probably benign Het
Herc1 T TN 9: 66,434,063 probably benign Homo
Homer3 T C 8: 70,286,335 Y115H probably benign Het
Ighv10-1 T A 12: 114,479,069 M99L probably benign Het
Kdm2b A C 5: 122,932,674 S398R probably damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mettl25 G A 10: 105,826,027 Q361* probably null Het
Mkrn2 T A 6: 115,613,535 I284N probably damaging Het
Mmp14 T A 14: 54,439,106 N369K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myo6 C G 9: 80,292,467 N1019K probably damaging Het
Myo7a C T 7: 98,056,767 V1857I probably damaging Het
Nktr T C 9: 121,746,466 S347P probably damaging Het
Nup210 T G 6: 91,030,190 D548A probably damaging Het
Nup210l A G 3: 90,190,887 Y1382C possibly damaging Het
Olfr295 G A 7: 86,586,012 V246M probably damaging Het
Olfr382 T A 11: 73,517,115 Y28F probably benign Het
Pax8 T C 2: 24,421,391 probably benign Het
Pcdhgb7 A G 18: 37,751,882 Y35C probably damaging Het
Pld1 A T 3: 28,029,167 R145S probably benign Het
Pom121 G A 5: 135,382,081 P741S unknown Het
Rarb T C 14: 16,436,910 N204D probably damaging Het
Sdc3 A G 4: 130,821,504 E337G probably benign Het
Serpina9 T C 12: 104,001,437 K233R probably null Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T A 6: 48,451,065 M159K probably benign Het
Stxbp4 C A 11: 90,607,184 R96S probably damaging Het
Tg A C 15: 66,740,718 E375A probably damaging Het
Tmem176b A G 6: 48,838,353 V2A probably benign Het
Toporsl G A 4: 52,610,281 C58Y probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vav3 T C 3: 109,563,094 probably benign Het
Zfp180 T A 7: 24,104,745 D196E possibly damaging Het
Zfp407 C T 18: 84,209,955 S1843N probably damaging Het
Other mutations in Cops7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Cops7b APN 1 86601106 missense probably damaging 1.00
IGL02505:Cops7b APN 1 86592321 missense probably benign 0.01
R0423:Cops7b UTSW 1 86599031 missense probably benign 0.07
R0479:Cops7b UTSW 1 86605076 missense probably benign 0.00
R1442:Cops7b UTSW 1 86605113 missense probably benign 0.00
R5004:Cops7b UTSW 1 86587410 unclassified probably benign
R5346:Cops7b UTSW 1 86583068 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GAGGAAGGAAGATTCACTTTTGAAC -3'
(R):5'- GCCTTCAGAGCACAGAAGATG -3'

Sequencing Primer
(F):5'- TTGGAAAGGACCTTAGAGACTACC -3'
(R):5'- GGAGATATAGTCAAGTCAACACCCTG -3'
Posted On2017-01-30