Incidental Mutation 'IGL03134:Dnajc19'
ID453148
Institutional Source Beutler Lab
Gene Symbol Dnajc19
Ensembl Gene ENSMUSG00000027679
Gene NameDnaJ heat shock protein family (Hsp40) member C19
Synonyms1810055D05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL03134 (G1)
Quality Score215
Status Validated
Chromosome3
Chromosomal Location34056020-34081321 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 34078735 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011029] [ENSMUST00000108195] [ENSMUST00000117223] [ENSMUST00000120805]
Predicted Effect probably benign
Transcript: ENSMUST00000011029
SMART Domains Protein: ENSMUSP00000011029
Gene: ENSMUSG00000027679

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
DnaJ 61 101 1.31e-1 SMART
low complexity region 106 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108195
SMART Domains Protein: ENSMUSP00000103830
Gene: ENSMUSG00000027679

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
DnaJ 61 115 1.05e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000117223
AA Change: I107T
SMART Domains Protein: ENSMUSP00000113484
Gene: ENSMUSG00000027679
AA Change: I107T

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
DnaJ 61 109 2.01e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120805
SMART Domains Protein: ENSMUSP00000113514
Gene: ENSMUSG00000027679

DomainStartEndE-ValueType
DnaJ 55 109 1.05e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197111
Meta Mutation Damage Score 0.0424 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (66/66)
MGI Phenotype Homozygous null mice display neonatal lethality with impaired muscle development. Mice homozygous for a hypomorphic allele display a reduced life span with impaired muscle development, growth retardation, and reduced grip strength.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414J04Rik A T 11: 21,507,249 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Afdn C T 17: 13,846,286 T580I probably benign Het
Ankfy1 G T 11: 72,712,185 L13F probably damaging Het
Arhgap12 T C 18: 6,111,936 T143A probably benign Het
Arsi T G 18: 60,917,352 W436G probably damaging Het
Bcl2l10 C T 9: 75,348,198 T99M probably damaging Het
C77080 A G 4: 129,222,487 S783P possibly damaging Het
Cacna1a A G 8: 84,559,087 Q740R probably damaging Het
Cacna1g A G 11: 94,459,825 F398S probably damaging Het
Ccrl2 A C 9: 111,055,657 Y258D probably damaging Het
Cemip T A 7: 83,999,237 D38V probably damaging Het
Chd6 C G 2: 160,965,483 C1937S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col1a2 T G 6: 4,521,387 probably benign Het
Col4a1 T C 8: 11,240,069 probably null Het
Cops7b T A 1: 86,592,334 L69Q probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Ddx3y T A Y: 1,278,949 D163V possibly damaging Het
Fam160b2 T C 14: 70,588,709 T288A possibly damaging Het
G2e3 T A 12: 51,364,030 probably benign Het
Gimap7 A G 6: 48,723,501 N7S probably benign Het
Gkap1 G A 13: 58,263,932 probably benign Het
Gm3404 G A 5: 146,526,896 R117Q probably benign Het
Herc1 T TN 9: 66,434,063 probably benign Homo
Homer3 T C 8: 70,286,335 Y115H probably benign Het
Ighv10-1 T A 12: 114,479,069 M99L probably benign Het
Kdm2b A C 5: 122,932,674 S398R probably damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mettl25 G A 10: 105,826,027 Q361* probably null Het
Mkrn2 T A 6: 115,613,535 I284N probably damaging Het
Mmp14 T A 14: 54,439,106 N369K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myo6 C G 9: 80,292,467 N1019K probably damaging Het
Myo7a C T 7: 98,056,767 V1857I probably damaging Het
Nktr T C 9: 121,746,466 S347P probably damaging Het
Nup210 T G 6: 91,030,190 D548A probably damaging Het
Nup210l A G 3: 90,190,887 Y1382C possibly damaging Het
Olfr295 G A 7: 86,586,012 V246M probably damaging Het
Olfr382 T A 11: 73,517,115 Y28F probably benign Het
Pax8 T C 2: 24,421,391 probably benign Het
Pcdhgb7 A G 18: 37,751,882 Y35C probably damaging Het
Pld1 A T 3: 28,029,167 R145S probably benign Het
Pom121 G A 5: 135,382,081 P741S unknown Het
Rarb T C 14: 16,436,910 N204D probably damaging Het
Sdc3 A G 4: 130,821,504 E337G probably benign Het
Serpina9 T C 12: 104,001,437 K233R probably null Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T A 6: 48,451,065 M159K probably benign Het
Stxbp4 C A 11: 90,607,184 R96S probably damaging Het
Tg A C 15: 66,740,718 E375A probably damaging Het
Tmem176b A G 6: 48,838,353 V2A probably benign Het
Toporsl G A 4: 52,610,281 C58Y probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vav3 T C 3: 109,563,094 probably benign Het
Zfp180 T A 7: 24,104,745 D196E possibly damaging Het
Zfp407 C T 18: 84,209,955 S1843N probably damaging Het
Other mutations in Dnajc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Dnajc19 APN 3 34078765 missense possibly damaging 0.81
FR4976:Dnajc19 UTSW 3 34057994 frame shift probably null
R1344:Dnajc19 UTSW 3 34058012 missense probably damaging 0.97
R1446:Dnajc19 UTSW 3 34057979 missense probably benign 0.00
R3703:Dnajc19 UTSW 3 34080229 critical splice donor site probably null
R3705:Dnajc19 UTSW 3 34080229 critical splice donor site probably null
R5234:Dnajc19 UTSW 3 34057959 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGCCAAATCACAGTAGTTCTTAC -3'
(R):5'- CAGCTTCTCAGTTGTGTTGC -3'

Sequencing Primer
(F):5'- TCACAGTAGTTCTTACATTGTTGTTC -3'
(R):5'- CTTCACTTCTGTAATAGTTCATGGTG -3'
Posted On2017-01-30