Incidental Mutation 'IGL03134:Speer4c'
ID453153
Institutional Source Beutler Lab
Gene Symbol Speer4c
Ensembl Gene ENSMUSG00000073208
Gene Namespermatogenesis associated glutamate (E)-rich protein 4C
Synonyms4933431D05Rik, SPEER-4C
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #IGL03134 (G1)
Quality Score82
Status Validated
Chromosome5
Chromosomal Location15709501-15714271 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to C at 15714216 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095005] [ENSMUST00000179506]
Predicted Effect probably benign
Transcript: ENSMUST00000095005
SMART Domains Protein: ENSMUSP00000133641
Gene: ENSMUSG00000073208

DomainStartEndE-ValueType
Pfam:Takusan 50 134 1.1e-30 PFAM
low complexity region 248 255 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162113
Predicted Effect probably benign
Transcript: ENSMUST00000179506
SMART Domains Protein: ENSMUSP00000136269
Gene: ENSMUSG00000073208

DomainStartEndE-ValueType
Pfam:Takusan 49 135 2.8e-25 PFAM
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414J04Rik A T 11: 21,507,249 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Afdn C T 17: 13,846,286 T580I probably benign Het
Ankfy1 G T 11: 72,712,185 L13F probably damaging Het
Arhgap12 T C 18: 6,111,936 T143A probably benign Het
Arsi T G 18: 60,917,352 W436G probably damaging Het
Bcl2l10 C T 9: 75,348,198 T99M probably damaging Het
C77080 A G 4: 129,222,487 S783P possibly damaging Het
Cacna1a A G 8: 84,559,087 Q740R probably damaging Het
Cacna1g A G 11: 94,459,825 F398S probably damaging Het
Ccrl2 A C 9: 111,055,657 Y258D probably damaging Het
Cemip T A 7: 83,999,237 D38V probably damaging Het
Chd6 C G 2: 160,965,483 C1937S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col1a2 T G 6: 4,521,387 probably benign Het
Col4a1 T C 8: 11,240,069 probably null Het
Cops7b T A 1: 86,592,334 L69Q probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Ddx3y T A Y: 1,278,949 D163V possibly damaging Het
Dnajc19 A G 3: 34,078,735 probably benign Het
Fam160b2 T C 14: 70,588,709 T288A possibly damaging Het
G2e3 T A 12: 51,364,030 probably benign Het
Gimap7 A G 6: 48,723,501 N7S probably benign Het
Gkap1 G A 13: 58,263,932 probably benign Het
Gm3404 G A 5: 146,526,896 R117Q probably benign Het
Herc1 T TN 9: 66,434,063 probably benign Homo
Homer3 T C 8: 70,286,335 Y115H probably benign Het
Ighv10-1 T A 12: 114,479,069 M99L probably benign Het
Kdm2b A C 5: 122,932,674 S398R probably damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mettl25 G A 10: 105,826,027 Q361* probably null Het
Mkrn2 T A 6: 115,613,535 I284N probably damaging Het
Mmp14 T A 14: 54,439,106 N369K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myo6 C G 9: 80,292,467 N1019K probably damaging Het
Myo7a C T 7: 98,056,767 V1857I probably damaging Het
Nktr T C 9: 121,746,466 S347P probably damaging Het
Nup210 T G 6: 91,030,190 D548A probably damaging Het
Nup210l A G 3: 90,190,887 Y1382C possibly damaging Het
Olfr295 G A 7: 86,586,012 V246M probably damaging Het
Olfr382 T A 11: 73,517,115 Y28F probably benign Het
Pax8 T C 2: 24,421,391 probably benign Het
Pcdhgb7 A G 18: 37,751,882 Y35C probably damaging Het
Pld1 A T 3: 28,029,167 R145S probably benign Het
Pom121 G A 5: 135,382,081 P741S unknown Het
Rarb T C 14: 16,436,910 N204D probably damaging Het
Sdc3 A G 4: 130,821,504 E337G probably benign Het
Serpina9 T C 12: 104,001,437 K233R probably null Het
Sspo T A 6: 48,451,065 M159K probably benign Het
Stxbp4 C A 11: 90,607,184 R96S probably damaging Het
Tg A C 15: 66,740,718 E375A probably damaging Het
Tmem176b A G 6: 48,838,353 V2A probably benign Het
Toporsl G A 4: 52,610,281 C58Y probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vav3 T C 3: 109,563,094 probably benign Het
Zfp180 T A 7: 24,104,745 D196E possibly damaging Het
Zfp407 C T 18: 84,209,955 S1843N probably damaging Het
Other mutations in Speer4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02796:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL02799:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL02802:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL02837:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL02984:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL02988:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL02991:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL03014:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL03046:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL03047:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL03050:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL03055:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL03097:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL03098:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL03138:Speer4c UTSW 5 15714216 utr 5 prime probably benign
IGL03147:Speer4c UTSW 5 15714216 utr 5 prime probably benign
R2122:Speer4c UTSW 5 15714117 missense possibly damaging 0.67
R7176:Speer4c UTSW 5 15711538 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATTACTGGAAAGGCCACC -3'
(R):5'- GCTCAGCTTCCTGTCAGTAC -3'

Sequencing Primer
(F):5'- TTACTGGAAAGGCCACCTCAGG -3'
(R):5'- TGTCAGTACAGGGAGAACATTAGC -3'
Posted On2017-01-30