Incidental Mutation 'IGL03134:Mkrn2'
ID453162
Institutional Source Beutler Lab
Gene Symbol Mkrn2
Ensembl Gene ENSMUSG00000000439
Gene Namemakorin, ring finger protein, 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03134 (G1)
Quality Score79
Status Validated
Chromosome6
Chromosomal Location115601902-115622624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115613535 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 284 (I284N)
Ref Sequence ENSEMBL: ENSMUSP00000000449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000449]
Predicted Effect probably damaging
Transcript: ENSMUST00000000449
AA Change: I284N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000449
Gene: ENSMUSG00000000439
AA Change: I284N

DomainStartEndE-ValueType
ZnF_C3H1 2 28 5.02e-6 SMART
ZnF_C3H1 32 57 1.75e-5 SMART
low complexity region 58 85 N/A INTRINSIC
ZnF_C3H1 165 191 2.79e-4 SMART
RING 238 291 5.82e-6 SMART
ZnF_C3H1 322 349 5.5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205248
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a probable E3 ubiquitin ligase containing several zinc finger domains, that is a member of the makorin RING zinc-finger protein family. This gene overlaps the v-raf-1 murine leukemia viral oncogene homolog 1 (RAF1) gene in an antisense orientation and may have a co-regulatory function with RAF1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414J04Rik A T 11: 21,507,249 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Afdn C T 17: 13,846,286 T580I probably benign Het
Ankfy1 G T 11: 72,712,185 L13F probably damaging Het
Arhgap12 T C 18: 6,111,936 T143A probably benign Het
Arsi T G 18: 60,917,352 W436G probably damaging Het
Bcl2l10 C T 9: 75,348,198 T99M probably damaging Het
C77080 A G 4: 129,222,487 S783P possibly damaging Het
Cacna1a A G 8: 84,559,087 Q740R probably damaging Het
Cacna1g A G 11: 94,459,825 F398S probably damaging Het
Ccrl2 A C 9: 111,055,657 Y258D probably damaging Het
Cemip T A 7: 83,999,237 D38V probably damaging Het
Chd6 C G 2: 160,965,483 C1937S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col1a2 T G 6: 4,521,387 probably benign Het
Col4a1 T C 8: 11,240,069 probably null Het
Cops7b T A 1: 86,592,334 L69Q probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Ddx3y T A Y: 1,278,949 D163V possibly damaging Het
Dnajc19 A G 3: 34,078,735 probably benign Het
Fam160b2 T C 14: 70,588,709 T288A possibly damaging Het
G2e3 T A 12: 51,364,030 probably benign Het
Gimap7 A G 6: 48,723,501 N7S probably benign Het
Gkap1 G A 13: 58,263,932 probably benign Het
Gm3404 G A 5: 146,526,896 R117Q probably benign Het
Herc1 T TN 9: 66,434,063 probably benign Homo
Homer3 T C 8: 70,286,335 Y115H probably benign Het
Ighv10-1 T A 12: 114,479,069 M99L probably benign Het
Kdm2b A C 5: 122,932,674 S398R probably damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mettl25 G A 10: 105,826,027 Q361* probably null Het
Mmp14 T A 14: 54,439,106 N369K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myo6 C G 9: 80,292,467 N1019K probably damaging Het
Myo7a C T 7: 98,056,767 V1857I probably damaging Het
Nktr T C 9: 121,746,466 S347P probably damaging Het
Nup210 T G 6: 91,030,190 D548A probably damaging Het
Nup210l A G 3: 90,190,887 Y1382C possibly damaging Het
Olfr295 G A 7: 86,586,012 V246M probably damaging Het
Olfr382 T A 11: 73,517,115 Y28F probably benign Het
Pax8 T C 2: 24,421,391 probably benign Het
Pcdhgb7 A G 18: 37,751,882 Y35C probably damaging Het
Pld1 A T 3: 28,029,167 R145S probably benign Het
Pom121 G A 5: 135,382,081 P741S unknown Het
Rarb T C 14: 16,436,910 N204D probably damaging Het
Sdc3 A G 4: 130,821,504 E337G probably benign Het
Serpina9 T C 12: 104,001,437 K233R probably null Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T A 6: 48,451,065 M159K probably benign Het
Stxbp4 C A 11: 90,607,184 R96S probably damaging Het
Tg A C 15: 66,740,718 E375A probably damaging Het
Tmem176b A G 6: 48,838,353 V2A probably benign Het
Toporsl G A 4: 52,610,281 C58Y probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vav3 T C 3: 109,563,094 probably benign Het
Zfp180 T A 7: 24,104,745 D196E possibly damaging Het
Zfp407 C T 18: 84,209,955 S1843N probably damaging Het
Other mutations in Mkrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Mkrn2 APN 6 115611789 nonsense probably null
IGL02996:Mkrn2 APN 6 115611907 missense probably benign 0.00
ANU18:Mkrn2 UTSW 6 115611789 nonsense probably null
R0086:Mkrn2 UTSW 6 115613335 missense possibly damaging 0.87
R0731:Mkrn2 UTSW 6 115614651 missense probably damaging 0.96
R1740:Mkrn2 UTSW 6 115613369 missense probably damaging 1.00
R1992:Mkrn2 UTSW 6 115609601 missense probably damaging 1.00
R2036:Mkrn2 UTSW 6 115611914 missense probably benign 0.28
R4291:Mkrn2 UTSW 6 115617434 missense possibly damaging 0.73
R4723:Mkrn2 UTSW 6 115611850 missense probably damaging 1.00
R6292:Mkrn2 UTSW 6 115613334 missense probably damaging 1.00
R6816:Mkrn2 UTSW 6 115611728 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGGATCTTGGCCAAAG -3'
(R):5'- AGGTAGACATGACAACTGTCC -3'

Sequencing Primer
(F):5'- CATTCTCAGATGTGTATGTCGAC -3'
(R):5'- TAGACATGACAACTGTCCATAAGG -3'
Posted On2017-01-30