Incidental Mutation 'IGL03134:Zfp180'
ID453163
Institutional Source Beutler Lab
Gene Symbol Zfp180
Ensembl Gene ENSMUSG00000057101
Gene Namezinc finger protein 180
SynonymsHHZ168, 2310040I01Rik, D130011P11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #IGL03134 (G1)
Quality Score116
Status Validated
Chromosome7
Chromosomal Location24081924-24107713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24104745 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 196 (D196E)
Ref Sequence ENSEMBL: ENSMUSP00000064611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068975] [ENSMUST00000203854] [ENSMUST00000206184] [ENSMUST00000207002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068975
AA Change: D196E

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064611
Gene: ENSMUSG00000057101
AA Change: D196E

DomainStartEndE-ValueType
Blast:KRAB 46 103 7e-14 BLAST
ZnF_C2H2 318 340 3.21e-4 SMART
ZnF_C2H2 346 368 3.39e-3 SMART
ZnF_C2H2 374 396 1.72e-4 SMART
ZnF_C2H2 402 424 4.87e-4 SMART
ZnF_C2H2 430 452 1.58e-3 SMART
ZnF_C2H2 458 480 5.99e-4 SMART
ZnF_C2H2 486 508 2.12e-4 SMART
ZnF_C2H2 514 536 1.6e-4 SMART
ZnF_C2H2 542 564 3.95e-4 SMART
ZnF_C2H2 570 592 5.9e-3 SMART
ZnF_C2H2 598 620 1.12e-3 SMART
ZnF_C2H2 626 648 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203854
SMART Domains Protein: ENSMUSP00000145165
Gene: ENSMUSG00000057101

DomainStartEndE-ValueType
Blast:KRAB 12 69 4e-14 BLAST
ZnF_C2H2 284 306 3.21e-4 SMART
ZnF_C2H2 312 334 3.39e-3 SMART
ZnF_C2H2 340 362 1.72e-4 SMART
ZnF_C2H2 368 390 4.87e-4 SMART
ZnF_C2H2 396 418 1.58e-3 SMART
ZnF_C2H2 424 446 5.99e-4 SMART
ZnF_C2H2 452 474 2.12e-4 SMART
ZnF_C2H2 480 502 1.6e-4 SMART
ZnF_C2H2 508 530 3.95e-4 SMART
ZnF_C2H2 536 558 5.9e-3 SMART
ZnF_C2H2 564 586 1.12e-3 SMART
ZnF_C2H2 592 614 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206482
Predicted Effect probably benign
Transcript: ENSMUST00000207002
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See MIM 604749 for additional information on zinc finger proteins.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414J04Rik A T 11: 21,507,249 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Afdn C T 17: 13,846,286 T580I probably benign Het
Ankfy1 G T 11: 72,712,185 L13F probably damaging Het
Arhgap12 T C 18: 6,111,936 T143A probably benign Het
Arsi T G 18: 60,917,352 W436G probably damaging Het
Bcl2l10 C T 9: 75,348,198 T99M probably damaging Het
C77080 A G 4: 129,222,487 S783P possibly damaging Het
Cacna1a A G 8: 84,559,087 Q740R probably damaging Het
Cacna1g A G 11: 94,459,825 F398S probably damaging Het
Ccrl2 A C 9: 111,055,657 Y258D probably damaging Het
Cemip T A 7: 83,999,237 D38V probably damaging Het
Chd6 C G 2: 160,965,483 C1937S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col1a2 T G 6: 4,521,387 probably benign Het
Col4a1 T C 8: 11,240,069 probably null Het
Cops7b T A 1: 86,592,334 L69Q probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Ddx3y T A Y: 1,278,949 D163V possibly damaging Het
Dnajc19 A G 3: 34,078,735 probably benign Het
Fam160b2 T C 14: 70,588,709 T288A possibly damaging Het
G2e3 T A 12: 51,364,030 probably benign Het
Gimap7 A G 6: 48,723,501 N7S probably benign Het
Gkap1 G A 13: 58,263,932 probably benign Het
Gm3404 G A 5: 146,526,896 R117Q probably benign Het
Herc1 T TN 9: 66,434,063 probably benign Homo
Homer3 T C 8: 70,286,335 Y115H probably benign Het
Ighv10-1 T A 12: 114,479,069 M99L probably benign Het
Kdm2b A C 5: 122,932,674 S398R probably damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mettl25 G A 10: 105,826,027 Q361* probably null Het
Mkrn2 T A 6: 115,613,535 I284N probably damaging Het
Mmp14 T A 14: 54,439,106 N369K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myo6 C G 9: 80,292,467 N1019K probably damaging Het
Myo7a C T 7: 98,056,767 V1857I probably damaging Het
Nktr T C 9: 121,746,466 S347P probably damaging Het
Nup210 T G 6: 91,030,190 D548A probably damaging Het
Nup210l A G 3: 90,190,887 Y1382C possibly damaging Het
Olfr295 G A 7: 86,586,012 V246M probably damaging Het
Olfr382 T A 11: 73,517,115 Y28F probably benign Het
Pax8 T C 2: 24,421,391 probably benign Het
Pcdhgb7 A G 18: 37,751,882 Y35C probably damaging Het
Pld1 A T 3: 28,029,167 R145S probably benign Het
Pom121 G A 5: 135,382,081 P741S unknown Het
Rarb T C 14: 16,436,910 N204D probably damaging Het
Sdc3 A G 4: 130,821,504 E337G probably benign Het
Serpina9 T C 12: 104,001,437 K233R probably null Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T A 6: 48,451,065 M159K probably benign Het
Stxbp4 C A 11: 90,607,184 R96S probably damaging Het
Tg A C 15: 66,740,718 E375A probably damaging Het
Tmem176b A G 6: 48,838,353 V2A probably benign Het
Toporsl G A 4: 52,610,281 C58Y probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vav3 T C 3: 109,563,094 probably benign Het
Zfp407 C T 18: 84,209,955 S1843N probably damaging Het
Other mutations in Zfp180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Zfp180 APN 7 24085469 missense probably damaging 0.98
IGL00990:Zfp180 APN 7 24104830 missense probably benign 0.42
IGL00990:Zfp180 APN 7 24104995 missense possibly damaging 0.60
IGL00990:Zfp180 APN 7 24104416 missense possibly damaging 0.83
IGL01061:Zfp180 APN 7 24104745 missense possibly damaging 0.50
IGL01328:Zfp180 APN 7 24101479 missense probably benign 0.01
R0137:Zfp180 UTSW 7 24105733 missense possibly damaging 0.93
R0390:Zfp180 UTSW 7 24104707 missense possibly damaging 0.95
R1451:Zfp180 UTSW 7 24105218 missense probably benign 0.00
R1534:Zfp180 UTSW 7 24101523 missense probably benign 0.31
R1555:Zfp180 UTSW 7 24101574 intron probably benign
R1577:Zfp180 UTSW 7 24105908 missense probably damaging 1.00
R1605:Zfp180 UTSW 7 24104624 missense probably benign 0.00
R1633:Zfp180 UTSW 7 24104801 missense probably benign 0.07
R1817:Zfp180 UTSW 7 24105227 missense probably damaging 1.00
R2012:Zfp180 UTSW 7 24104518 missense probably benign 0.01
R2076:Zfp180 UTSW 7 24105103 missense probably damaging 1.00
R2151:Zfp180 UTSW 7 24105260 missense probably damaging 1.00
R2262:Zfp180 UTSW 7 24104624 missense probably benign 0.32
R3081:Zfp180 UTSW 7 24105503 missense probably damaging 1.00
R3402:Zfp180 UTSW 7 24105745 missense probably benign 0.30
R4551:Zfp180 UTSW 7 24104573 missense possibly damaging 0.87
R4747:Zfp180 UTSW 7 24105821 missense probably damaging 1.00
R4983:Zfp180 UTSW 7 24106078 missense probably damaging 0.98
R5610:Zfp180 UTSW 7 24104890 missense probably benign 0.00
R5764:Zfp180 UTSW 7 24101484 missense possibly damaging 0.71
R5987:Zfp180 UTSW 7 24105434 missense probably damaging 1.00
R6207:Zfp180 UTSW 7 24105085 nonsense probably null
R6247:Zfp180 UTSW 7 24105105 missense probably damaging 1.00
R6328:Zfp180 UTSW 7 24105556 missense probably damaging 1.00
R6708:Zfp180 UTSW 7 24106096 missense probably damaging 0.98
R6814:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R6872:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R7006:Zfp180 UTSW 7 24105112 nonsense probably null
R7084:Zfp180 UTSW 7 24105261 missense probably damaging 1.00
R7101:Zfp180 UTSW 7 24104533 missense probably benign 0.00
R7213:Zfp180 UTSW 7 24104513 missense possibly damaging 0.87
R7263:Zfp180 UTSW 7 24105700 nonsense probably null
R7360:Zfp180 UTSW 7 24105490 missense probably damaging 1.00
V5622:Zfp180 UTSW 7 24082031 start gained probably benign
X0067:Zfp180 UTSW 7 24105472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACATGTGAAGAAGTCCGAG -3'
(R):5'- TTTAGATTTCGGGGCGCACC -3'

Sequencing Primer
(F):5'- TCCGAGACTGTAAGGAGCAGTC -3'
(R):5'- CTCGGCCAGAAGCTTGAACATG -3'
Posted On2017-01-30