Incidental Mutation 'IGL03134:Cacna1a'
ID453169
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Namecalcium channel, voltage-dependent, P/Q type, alpha 1A subunit
SynonymsCacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #IGL03134 (G1)
Quality Score86
Status Validated
Chromosome8
Chromosomal Location84388440-84640246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84559087 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 740 (Q740R)
Ref Sequence ENSEMBL: ENSMUSP00000114055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
Predicted Effect probably benign
Transcript: ENSMUST00000121390
AA Change: Q787R

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: Q787R

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122053
AA Change: Q740R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: Q740R

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000215756
AA Change: Q739R
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414J04Rik A T 11: 21,507,249 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Afdn C T 17: 13,846,286 T580I probably benign Het
Ankfy1 G T 11: 72,712,185 L13F probably damaging Het
Arhgap12 T C 18: 6,111,936 T143A probably benign Het
Arsi T G 18: 60,917,352 W436G probably damaging Het
Bcl2l10 C T 9: 75,348,198 T99M probably damaging Het
C77080 A G 4: 129,222,487 S783P possibly damaging Het
Cacna1g A G 11: 94,459,825 F398S probably damaging Het
Ccrl2 A C 9: 111,055,657 Y258D probably damaging Het
Cemip T A 7: 83,999,237 D38V probably damaging Het
Chd6 C G 2: 160,965,483 C1937S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col1a2 T G 6: 4,521,387 probably benign Het
Col4a1 T C 8: 11,240,069 probably null Het
Cops7b T A 1: 86,592,334 L69Q probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Ddx3y T A Y: 1,278,949 D163V possibly damaging Het
Dnajc19 A G 3: 34,078,735 probably benign Het
Fam160b2 T C 14: 70,588,709 T288A possibly damaging Het
G2e3 T A 12: 51,364,030 probably benign Het
Gimap7 A G 6: 48,723,501 N7S probably benign Het
Gkap1 G A 13: 58,263,932 probably benign Het
Gm3404 G A 5: 146,526,896 R117Q probably benign Het
Herc1 T TN 9: 66,434,063 probably benign Homo
Homer3 T C 8: 70,286,335 Y115H probably benign Het
Ighv10-1 T A 12: 114,479,069 M99L probably benign Het
Kdm2b A C 5: 122,932,674 S398R probably damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mettl25 G A 10: 105,826,027 Q361* probably null Het
Mkrn2 T A 6: 115,613,535 I284N probably damaging Het
Mmp14 T A 14: 54,439,106 N369K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myo6 C G 9: 80,292,467 N1019K probably damaging Het
Myo7a C T 7: 98,056,767 V1857I probably damaging Het
Nktr T C 9: 121,746,466 S347P probably damaging Het
Nup210 T G 6: 91,030,190 D548A probably damaging Het
Nup210l A G 3: 90,190,887 Y1382C possibly damaging Het
Olfr295 G A 7: 86,586,012 V246M probably damaging Het
Olfr382 T A 11: 73,517,115 Y28F probably benign Het
Pax8 T C 2: 24,421,391 probably benign Het
Pcdhgb7 A G 18: 37,751,882 Y35C probably damaging Het
Pld1 A T 3: 28,029,167 R145S probably benign Het
Pom121 G A 5: 135,382,081 P741S unknown Het
Rarb T C 14: 16,436,910 N204D probably damaging Het
Sdc3 A G 4: 130,821,504 E337G probably benign Het
Serpina9 T C 12: 104,001,437 K233R probably null Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T A 6: 48,451,065 M159K probably benign Het
Stxbp4 C A 11: 90,607,184 R96S probably damaging Het
Tg A C 15: 66,740,718 E375A probably damaging Het
Tmem176b A G 6: 48,838,353 V2A probably benign Het
Toporsl G A 4: 52,610,281 C58Y probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vav3 T C 3: 109,563,094 probably benign Het
Zfp180 T A 7: 24,104,745 D196E possibly damaging Het
Zfp407 C T 18: 84,209,955 S1843N probably damaging Het
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably null
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5786:Cacna1a UTSW 8 84415721 unclassified probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
R6980:Cacna1a UTSW 8 84612285 missense possibly damaging 0.85
R7051:Cacna1a UTSW 8 84629915 missense possibly damaging 0.85
R7270:Cacna1a UTSW 8 84571237 missense probably damaging 1.00
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGAATCCACTGGAGTTGCGG -3'
(R):5'- ACTCACTTTCTGCGTCGGTG -3'

Sequencing Primer
(F):5'- ACCTTCGTTATCCGACCA -3'
(R):5'- ATACGGGCCCTCTCGTC -3'
Posted On2017-01-30