Incidental Mutation 'IGL03134:Ccrl2'
ID453175
Institutional Source Beutler Lab
Gene Symbol Ccrl2
Ensembl Gene ENSMUSG00000043953
Gene Namechemokine (C-C motif) receptor-like 2
SynonymsCCR11, Cmkbr1l2, L-CCR
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03134 (G1)
Quality Score164
Status Validated
Chromosome9
Chromosomal Location111054486-111057519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 111055657 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 258 (Y258D)
Ref Sequence ENSEMBL: ENSMUSP00000143116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111888] [ENSMUST00000195968] [ENSMUST00000199839]
Predicted Effect probably damaging
Transcript: ENSMUST00000111888
AA Change: Y258D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107519
Gene: ENSMUSG00000043953
AA Change: Y258D

DomainStartEndE-ValueType
Pfam:7tm_1 54 304 6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195968
SMART Domains Protein: ENSMUSP00000143105
Gene: ENSMUSG00000043953

DomainStartEndE-ValueType
Pfam:7tm_1 54 130 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197851
Predicted Effect probably damaging
Transcript: ENSMUST00000199839
AA Change: Y258D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143116
Gene: ENSMUSG00000043953
AA Change: Y258D

DomainStartEndE-ValueType
Pfam:7tm_1 54 304 4.2e-31 PFAM
Meta Mutation Damage Score 0.504 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chemokine receptor like protein, which is predicted to be a seven transmembrane protein and most closely related to CCR1. Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. This gene is expressed at high levels in primary neutrophils and primary monocytes, and is further upregulated on neutrophil activation and during monocyte to macrophage differentiation. The function of this gene is unknown. This gene is mapped to the region where the chemokine receptor gene cluster is located. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414J04Rik A T 11: 21,507,249 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Afdn C T 17: 13,846,286 T580I probably benign Het
Ankfy1 G T 11: 72,712,185 L13F probably damaging Het
Arhgap12 T C 18: 6,111,936 T143A probably benign Het
Arsi T G 18: 60,917,352 W436G probably damaging Het
Bcl2l10 C T 9: 75,348,198 T99M probably damaging Het
C77080 A G 4: 129,222,487 S783P possibly damaging Het
Cacna1a A G 8: 84,559,087 Q740R probably damaging Het
Cacna1g A G 11: 94,459,825 F398S probably damaging Het
Cemip T A 7: 83,999,237 D38V probably damaging Het
Chd6 C G 2: 160,965,483 C1937S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col1a2 T G 6: 4,521,387 probably benign Het
Col4a1 T C 8: 11,240,069 probably null Het
Cops7b T A 1: 86,592,334 L69Q probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Ddx3y T A Y: 1,278,949 D163V possibly damaging Het
Dnajc19 A G 3: 34,078,735 probably benign Het
Fam160b2 T C 14: 70,588,709 T288A possibly damaging Het
G2e3 T A 12: 51,364,030 probably benign Het
Gimap7 A G 6: 48,723,501 N7S probably benign Het
Gkap1 G A 13: 58,263,932 probably benign Het
Gm3404 G A 5: 146,526,896 R117Q probably benign Het
Herc1 T TN 9: 66,434,063 probably benign Homo
Homer3 T C 8: 70,286,335 Y115H probably benign Het
Ighv10-1 T A 12: 114,479,069 M99L probably benign Het
Kdm2b A C 5: 122,932,674 S398R probably damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mettl25 G A 10: 105,826,027 Q361* probably null Het
Mkrn2 T A 6: 115,613,535 I284N probably damaging Het
Mmp14 T A 14: 54,439,106 N369K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myo6 C G 9: 80,292,467 N1019K probably damaging Het
Myo7a C T 7: 98,056,767 V1857I probably damaging Het
Nktr T C 9: 121,746,466 S347P probably damaging Het
Nup210 T G 6: 91,030,190 D548A probably damaging Het
Nup210l A G 3: 90,190,887 Y1382C possibly damaging Het
Olfr295 G A 7: 86,586,012 V246M probably damaging Het
Olfr382 T A 11: 73,517,115 Y28F probably benign Het
Pax8 T C 2: 24,421,391 probably benign Het
Pcdhgb7 A G 18: 37,751,882 Y35C probably damaging Het
Pld1 A T 3: 28,029,167 R145S probably benign Het
Pom121 G A 5: 135,382,081 P741S unknown Het
Rarb T C 14: 16,436,910 N204D probably damaging Het
Sdc3 A G 4: 130,821,504 E337G probably benign Het
Serpina9 T C 12: 104,001,437 K233R probably null Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T A 6: 48,451,065 M159K probably benign Het
Stxbp4 C A 11: 90,607,184 R96S probably damaging Het
Tg A C 15: 66,740,718 E375A probably damaging Het
Tmem176b A G 6: 48,838,353 V2A probably benign Het
Toporsl G A 4: 52,610,281 C58Y probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vav3 T C 3: 109,563,094 probably benign Het
Zfp180 T A 7: 24,104,745 D196E possibly damaging Het
Zfp407 C T 18: 84,209,955 S1843N probably damaging Het
Other mutations in Ccrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02382:Ccrl2 APN 9 111055879 missense probably benign 0.22
IGL02492:Ccrl2 APN 9 111055803 missense probably benign 0.01
octomom UTSW 9 111055987 unclassified probably null
R0321:Ccrl2 UTSW 9 111056211 missense probably damaging 0.97
R0924:Ccrl2 UTSW 9 111055968 missense probably benign 0.39
R0967:Ccrl2 UTSW 9 111055686 missense probably benign 0.02
R2033:Ccrl2 UTSW 9 111055870 missense possibly damaging 0.95
R3720:Ccrl2 UTSW 9 111056364 missense probably benign 0.01
R3721:Ccrl2 UTSW 9 111056364 missense probably benign 0.01
R4244:Ccrl2 UTSW 9 111055354 missense probably benign 0.33
R5634:Ccrl2 UTSW 9 111055987 unclassified probably null
R7027:Ccrl2 UTSW 9 111055885 missense probably benign 0.11
R7060:Ccrl2 UTSW 9 111055614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATTGCACCGTGGGAACAG -3'
(R):5'- TTCTTGCCAATCGAAGCGCC -3'

Sequencing Primer
(F):5'- CTGCGAAGGTATCTCATAAAGGCC -3'
(R):5'- CGCTCTGGAAGTACGTTCTGAC -3'
Posted On2017-01-30