Incidental Mutation 'IGL03134:Ddx3y'
ID453196
Institutional Source Beutler Lab
Gene Symbol Ddx3y
Ensembl Gene ENSMUSG00000069045
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
SynonymsDby, D1Pas1-rs1, 8030469F12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #IGL03134 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location1260771-1286629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 1278949 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 163 (D163V)
Ref Sequence ENSEMBL: ENSMUSP00000088729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091190] [ENSMUST00000188484]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091190
AA Change: D163V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088729
Gene: ENSMUSG00000069045
AA Change: D163V

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
DEXDc 198 417 3.39e-65 SMART
HELICc 454 535 2.61e-34 SMART
low complexity region 580 596 N/A INTRINSIC
low complexity region 603 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189783
Meta Mutation Damage Score 0.2608 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the DEAD-box RNA helicase family, characterized by nine conserved motifs, included the conserved Asp-Glu-Ala-Asp (DEAD) motif. These motifs are thought to be involved in ATP binding, hydrolysis, RNA binding, and in the formation of intramolecular interactions. This protein shares high similarity to DDX3X, on the X chromosome, but a deletion of this gene is not complemented by DDX3X. Mutations in this gene result in male infertility, a reduction in germ cell numbers, and can result in Sertoli-cell only sydrome. Pseudogenes sharing similarity to both this gene and the DDX3X paralog are found on chromosome 4 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414J04Rik A T 11: 21,507,249 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Afdn C T 17: 13,846,286 T580I probably benign Het
Ankfy1 G T 11: 72,712,185 L13F probably damaging Het
Arhgap12 T C 18: 6,111,936 T143A probably benign Het
Arsi T G 18: 60,917,352 W436G probably damaging Het
Bcl2l10 C T 9: 75,348,198 T99M probably damaging Het
C77080 A G 4: 129,222,487 S783P possibly damaging Het
Cacna1a A G 8: 84,559,087 Q740R probably damaging Het
Cacna1g A G 11: 94,459,825 F398S probably damaging Het
Ccrl2 A C 9: 111,055,657 Y258D probably damaging Het
Cemip T A 7: 83,999,237 D38V probably damaging Het
Chd6 C G 2: 160,965,483 C1937S possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col1a2 T G 6: 4,521,387 probably benign Het
Col4a1 T C 8: 11,240,069 probably null Het
Cops7b T A 1: 86,592,334 L69Q probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Dnajc19 A G 3: 34,078,735 probably benign Het
Fam160b2 T C 14: 70,588,709 T288A possibly damaging Het
G2e3 T A 12: 51,364,030 probably benign Het
Gimap7 A G 6: 48,723,501 N7S probably benign Het
Gkap1 G A 13: 58,263,932 probably benign Het
Gm3404 G A 5: 146,526,896 R117Q probably benign Het
Herc1 T TN 9: 66,434,063 probably benign Homo
Homer3 T C 8: 70,286,335 Y115H probably benign Het
Ighv10-1 T A 12: 114,479,069 M99L probably benign Het
Kdm2b A C 5: 122,932,674 S398R probably damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mettl25 G A 10: 105,826,027 Q361* probably null Het
Mkrn2 T A 6: 115,613,535 I284N probably damaging Het
Mmp14 T A 14: 54,439,106 N369K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myo6 C G 9: 80,292,467 N1019K probably damaging Het
Myo7a C T 7: 98,056,767 V1857I probably damaging Het
Nktr T C 9: 121,746,466 S347P probably damaging Het
Nup210 T G 6: 91,030,190 D548A probably damaging Het
Nup210l A G 3: 90,190,887 Y1382C possibly damaging Het
Olfr295 G A 7: 86,586,012 V246M probably damaging Het
Olfr382 T A 11: 73,517,115 Y28F probably benign Het
Pax8 T C 2: 24,421,391 probably benign Het
Pcdhgb7 A G 18: 37,751,882 Y35C probably damaging Het
Pld1 A T 3: 28,029,167 R145S probably benign Het
Pom121 G A 5: 135,382,081 P741S unknown Het
Rarb T C 14: 16,436,910 N204D probably damaging Het
Sdc3 A G 4: 130,821,504 E337G probably benign Het
Serpina9 T C 12: 104,001,437 K233R probably null Het
Speer4c A C 5: 15,714,216 probably benign Het
Sspo T A 6: 48,451,065 M159K probably benign Het
Stxbp4 C A 11: 90,607,184 R96S probably damaging Het
Tg A C 15: 66,740,718 E375A probably damaging Het
Tmem176b A G 6: 48,838,353 V2A probably benign Het
Toporsl G A 4: 52,610,281 C58Y probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vav3 T C 3: 109,563,094 probably benign Het
Zfp180 T A 7: 24,104,745 D196E possibly damaging Het
Zfp407 C T 18: 84,209,955 S1843N probably damaging Het
Other mutations in Ddx3y
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0326:Ddx3y UTSW Y 1263321 nonsense probably null
R1755:Ddx3y UTSW Y 1279543 missense probably benign 0.00
R2029:Ddx3y UTSW Y 1266389 missense probably benign 0.05
R2076:Ddx3y UTSW Y 1266593 critical splice donor site probably null
R3610:Ddx3y UTSW Y 1263928 missense probably null 1.00
R3973:Ddx3y UTSW Y 1267170 missense probably damaging 1.00
R5041:Ddx3y UTSW Y 1266611 missense probably benign 0.05
R5396:Ddx3y UTSW Y 1265965 missense probably damaging 1.00
R6266:Ddx3y UTSW Y 1266635 missense probably damaging 1.00
R6473:Ddx3y UTSW Y 1265971 missense possibly damaging 0.93
R7048:Ddx3y UTSW Y 1279491 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGCTCCCCTCACAAGTTG -3'
(R):5'- CATGTGTCTAATAGACCCACTCAG -3'

Sequencing Primer
(F):5'- GTCCTCTGACATCAAAAGTGGTAC -3'
(R):5'- TCTAATAGACCCACTCAGAAAGATTC -3'
Posted On2017-01-30