Incidental Mutation 'IGL03097:Ak5'
ID453206
Institutional Source Beutler Lab
Gene Symbol Ak5
Ensembl Gene ENSMUSG00000039058
Gene Nameadenylate kinase 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #IGL03097 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location152462815-152668360 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 152660514 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045262]
Predicted Effect probably null
Transcript: ENSMUST00000045262
SMART Domains Protein: ENSMUSP00000042785
Gene: ENSMUSG00000039058

DomainStartEndE-ValueType
Pfam:AAA_17 134 263 1.1e-8 PFAM
Pfam:AAA_18 135 274 3e-10 PFAM
Pfam:ADK 137 294 5.8e-35 PFAM
Pfam:AAA_17 378 525 2.9e-8 PFAM
Pfam:ADK 381 537 1.9e-45 PFAM
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 90% (46/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylate kinase family, which is involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. This member is related to the UMP/CMP kinase of several species. It is located in the cytosol and expressed exclusively in brain. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adcy9 T C 16: 4,418,066 T257A possibly damaging Het
Ahnak A G 19: 9,002,387 D345G probably benign Het
Akap3 A G 6: 126,866,416 K666R probably damaging Het
Alpk3 A G 7: 81,093,909 N1158S probably benign Het
Atp23 A T 10: 126,887,687 V182E probably damaging Het
Atp4a A G 7: 30,723,037 D898G probably benign Het
Bnip3 T C 7: 138,894,479 N140S probably damaging Het
Bptf T C 11: 107,077,680 Y1059C probably damaging Het
Cacna1h A T 17: 25,391,144 I796N probably damaging Het
Ccnb2 A G 9: 70,409,396 probably benign Het
Cd3g T A 9: 44,970,763 D165V probably damaging Het
Cfap70 T C 14: 20,448,608 T4A probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Cntn4 C T 6: 106,353,712 T97M probably benign Het
Crb1 CG C 1: 139,237,086 probably null Het
Crim1 C T 17: 78,367,798 T812I probably benign Het
Csmd1 G T 8: 15,945,127 T2636K probably damaging Het
Cyp39a1 T A 17: 43,683,050 Y200* probably null Het
Dlg4 T G 11: 70,042,202 I478S probably damaging Het
Dsc3 A T 18: 19,974,048 N505K probably benign Het
Efhc1 T C 1: 20,972,825 W323R probably damaging Het
Ehhadh T A 16: 21,762,770 I491L probably benign Het
Ggt6 T G 11: 72,436,813 H148Q possibly damaging Het
Gstm3 T C 3: 107,968,801 D25G probably benign Het
Gtf2h3 G A 5: 124,602,168 probably benign Het
Hjurp TGGG TTGCGGG 1: 88,266,280 probably benign Het
Hnf4g A C 3: 3,651,614 E281A probably damaging Het
Impg1 T G 9: 80,379,952 E404A possibly damaging Het
Kcna2 T C 3: 107,105,399 V432A probably benign Het
Map3k2 T G 18: 32,200,017 D81E probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mmp9 T A 2: 164,950,806 probably null Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Ms4a1 G T 19: 11,253,192 T215N probably benign Het
Pam16 T C 16: 4,616,594 I111V probably benign Het
Pde6c A G 19: 38,178,271 T720A probably damaging Het
Pgap2 T C 7: 102,236,227 L100P probably damaging Het
Ppl T A 16: 5,096,726 S686C probably damaging Het
Rnls A G 19: 33,138,279 probably benign Het
Robo3 A C 9: 37,422,528 probably null Het
Rptn G A 3: 93,397,373 G671D probably damaging Het
Slc6a21 C T 7: 45,288,168 Q628* probably null Het
Smg6 T G 11: 74,932,426 I708S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thap1 C G 8: 26,162,470 P79A probably benign Het
Vmn1r202 G A 13: 22,501,470 T259I probably benign Het
Other mutations in Ak5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02178:Ak5 APN 3 152526785 missense probably benign 0.28
IGL02237:Ak5 APN 3 152499343 missense probably benign 0.44
IGL02661:Ak5 APN 3 152463956 missense probably benign
R0645:Ak5 UTSW 3 152653615 missense probably damaging 1.00
R1135:Ak5 UTSW 3 152653662 missense probably damaging 1.00
R1346:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1347:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1347:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1349:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1749:Ak5 UTSW 3 152472920 missense probably damaging 0.99
R2059:Ak5 UTSW 3 152660637 missense probably damaging 1.00
R3929:Ak5 UTSW 3 152667807 missense probably damaging 0.98
R4433:Ak5 UTSW 3 152655880 missense probably damaging 1.00
R4909:Ak5 UTSW 3 152655877 missense probably damaging 1.00
R5052:Ak5 UTSW 3 152660567 missense probably benign 0.00
R5097:Ak5 UTSW 3 152481633 missense probably damaging 0.99
R5645:Ak5 UTSW 3 152656033 missense possibly damaging 0.92
R5907:Ak5 UTSW 3 152615952 missense probably damaging 1.00
R6505:Ak5 UTSW 3 152481669 missense probably benign 0.01
R7117:Ak5 UTSW 3 152615856 critical splice donor site probably null
R7397:Ak5 UTSW 3 152478352 missense probably damaging 1.00
X0023:Ak5 UTSW 3 152616027 missense probably damaging 1.00
X0024:Ak5 UTSW 3 152653597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTATTTGGGAAAAGCCTATTTGC -3'
(R):5'- TGTTCCAAGCCAGAAGACCC -3'

Sequencing Primer
(F):5'- AAAATCGCCTGATAATGGTGTG -3'
(R):5'- GACCCCATAGAGTACTTGGAAACTTG -3'
Posted On2017-01-31